MENU
The Electronic Scholarly Publishing Project: Providing world-wide, free access to classic scientific papers and other scholarly materials, since 1993.
More About: ESP | OUR CONTENT | THIS WEBSITE | WHAT'S NEW | WHAT'S HOT
ESP: PubMed Auto Bibliography 23 Mar 2026 at 01:49 Created:
Invasive Species
Standard Definition: Invasive species are plants, animals, or pathogens that are non-native (or alien) to the ecosystem under consideration and whose introduction causes or is likely to cause harm. Although that definition allows a logical possibility that some species might be non-native and harmless, most of time it seems that invasive species and really bad critter (or weed) that should be eradicated are seen as equivalent phrases. But, there is a big conceptual problem with that notion: every species in every ecosystem started out in that ecosystem as an invader. If there were no invasive species, all of Hawaii would be nothing but bare volcanic rock. Without an invasion of species onto land, there would be no terrestrial ecosystems at all. For the entire history of life on Earth, the biosphere has responded to perturbation and to opportunity with evolutionary innovation and with physical movement. While one may raise economic or aesthetic arguments against invasive species, it is impossible to make such an argument on scientific grounds. Species movement — the occurrence of invasive species — is the way the biosphere responds to perturbation. One might even argue that species movement is the primary, short-term "healing" mechanism employed by the biosphere to respond to perturbation — to "damage." As with any healing process, the short-term effect may be aesthetically unappealing (who thinks scabs are appealing?), but the long-term effects can be glorious.
Created with PubMed® Query: ("invasive species" OR "invasion biology" OR "alien species" OR "introduced species" ) NOT pmcbook NOT ispreviousversion
Citations The Papers (from PubMed®)
RevDate: 2026-03-21
Promising biocontrol effects of a native hemiparasitic plant against a non-native C4 grass.
Scientific reports pii:10.1038/s41598-026-44801-0 [Epub ahead of print].
Hemiparasitic plants are known to be able to diversify degraded grasslands by lowering the competitive power of dominant grasses. Recent research indicates that hemiparasites may also be used against invasive alien plants. Here, we tested the effects of Odontites luteus, a native European hemiparasite, on Sporobolus cryptandrus, a recently established and rapidly spreading C4 grass of North-American origin. We found that Odontites considers Sporobolus a suitable host and reduces its biomass production (and potentially its competitive ability) by approx. 50%, equaling the effect on its major native host, Festuca vaginata. However, Festuca showed severe metabolic impairment (reduced photosynthetic capacity and increased physiological stress) under hemiparasite pressure. So, the application of hemiparasites is a promising biocontrol tool against Sporobolus (and potentially other invasive C4 grasses), but it is not a silver bullet. We cannot expect a full eradication of the invasive species and a recovery of the native community but thinning monodominant Sporobolus stands to allow certain populations of native species, particularly those resistant to Odontites, to come back is a more realistic goal. This could lead to a partial recovery of the former species composition and an improvement of ecosystem functions, such as providing food for pollinators.
Additional Links: PMID-41862543
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41862543,
year = {2026},
author = {Tölgyesi, C and Hábenczyus, AA and Molnár, F and Bán, KA and Lőrincz, Á and Frei, K and Bátori, Z and Erdős, L and Czékus, Z and Ördög, A and Kovács, KT and Török, P and Poór, P},
title = {Promising biocontrol effects of a native hemiparasitic plant against a non-native C4 grass.},
journal = {Scientific reports},
volume = {},
number = {},
pages = {},
doi = {10.1038/s41598-026-44801-0},
pmid = {41862543},
issn = {2045-2322},
abstract = {Hemiparasitic plants are known to be able to diversify degraded grasslands by lowering the competitive power of dominant grasses. Recent research indicates that hemiparasites may also be used against invasive alien plants. Here, we tested the effects of Odontites luteus, a native European hemiparasite, on Sporobolus cryptandrus, a recently established and rapidly spreading C4 grass of North-American origin. We found that Odontites considers Sporobolus a suitable host and reduces its biomass production (and potentially its competitive ability) by approx. 50%, equaling the effect on its major native host, Festuca vaginata. However, Festuca showed severe metabolic impairment (reduced photosynthetic capacity and increased physiological stress) under hemiparasite pressure. So, the application of hemiparasites is a promising biocontrol tool against Sporobolus (and potentially other invasive C4 grasses), but it is not a silver bullet. We cannot expect a full eradication of the invasive species and a recovery of the native community but thinning monodominant Sporobolus stands to allow certain populations of native species, particularly those resistant to Odontites, to come back is a more realistic goal. This could lead to a partial recovery of the former species composition and an improvement of ecosystem functions, such as providing food for pollinators.},
}
RevDate: 2026-03-21
Invasion dynamics of Corythucha ciliata (Say, 1832) in China: evidence of niche shifts and assessment of potential risk to urban and forest areas.
Journal of environmental management, 404:129394 pii:S0301-4797(26)00854-6 [Epub ahead of print].
Corythucha ciliata (Say, 1832) is a highly invasive species originating from North America that has expanded across the Northern Hemisphere since the 1960s. While broadly problematic, this pest poses particularly significant ecological and economic threats to Platanus spp. in China. To evaluate the invasion potential of C. ciliata in China under global change, we analyzed ecological niche dynamics and projected its future distribution by integrating occurrence data from both native and invasive ranges with bioclimatic, topographic, and land-use variables. Niche shifts between the native (North America) and invasive (China) ranges were quantified using the centroid shift, overlap, unfilling, and expansion framework. An ensemble species distribution modeling approach was applied to predict current and future habitat suitability across China under scenarios that jointly consider climate and land use change. Results revealed low niche overlap and substantial expansion in China, indicating a shift toward novel climatic conditions. Isothermality, mean temperature of the wettest quarter, and precipitation of the coldest quarter were key predictors of habitat suitability. The current potential distribution is concentrated in eastern and central China. Future projections suggest a general contraction in suitable habitat, particularly under high-emission scenarios, but with a marked increase in invasion risk to urban areas. Subtropical forest regions are expected to remain highly vulnerable. These findings highlight the climatic adaptability of C. ciliata. We recommend strict quarantine in high-risk subtropical zones and diversifying urban street trees to mitigate future invasion risks.
Additional Links: PMID-41863943
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41863943,
year = {2026},
author = {Mao, X and Zheng, H and Luo, G and Liao, S and Liu, Y and Tang, M and Chen, H},
title = {Invasion dynamics of Corythucha ciliata (Say, 1832) in China: evidence of niche shifts and assessment of potential risk to urban and forest areas.},
journal = {Journal of environmental management},
volume = {404},
number = {},
pages = {129394},
doi = {10.1016/j.jenvman.2026.129394},
pmid = {41863943},
issn = {1095-8630},
abstract = {Corythucha ciliata (Say, 1832) is a highly invasive species originating from North America that has expanded across the Northern Hemisphere since the 1960s. While broadly problematic, this pest poses particularly significant ecological and economic threats to Platanus spp. in China. To evaluate the invasion potential of C. ciliata in China under global change, we analyzed ecological niche dynamics and projected its future distribution by integrating occurrence data from both native and invasive ranges with bioclimatic, topographic, and land-use variables. Niche shifts between the native (North America) and invasive (China) ranges were quantified using the centroid shift, overlap, unfilling, and expansion framework. An ensemble species distribution modeling approach was applied to predict current and future habitat suitability across China under scenarios that jointly consider climate and land use change. Results revealed low niche overlap and substantial expansion in China, indicating a shift toward novel climatic conditions. Isothermality, mean temperature of the wettest quarter, and precipitation of the coldest quarter were key predictors of habitat suitability. The current potential distribution is concentrated in eastern and central China. Future projections suggest a general contraction in suitable habitat, particularly under high-emission scenarios, but with a marked increase in invasion risk to urban areas. Subtropical forest regions are expected to remain highly vulnerable. These findings highlight the climatic adaptability of C. ciliata. We recommend strict quarantine in high-risk subtropical zones and diversifying urban street trees to mitigate future invasion risks.},
}
RevDate: 2026-03-22
Honey bee genetic resistance outperforms a cold-storage induced halt in brood production to control mites and viruses.
Scientific reports pii:10.1038/s41598-026-44701-3 [Epub ahead of print].
Additional Links: PMID-41865076
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41865076,
year = {2026},
author = {Meikle, WG and Weiss, M and Adjaye, D and Ricigliano, VA},
title = {Honey bee genetic resistance outperforms a cold-storage induced halt in brood production to control mites and viruses.},
journal = {Scientific reports},
volume = {},
number = {},
pages = {},
doi = {10.1038/s41598-026-44701-3},
pmid = {41865076},
issn = {2045-2322},
}
RevDate: 2026-03-20
First record of the invasive American tapeworm Ophiotaenia saphena (Cestoda: Proteocephalidae) in the Tokyo daruma pond frog Pelophylax porosus porosus in Japan.
Parasitology international pii:S1383-5769(26)00041-3 [Epub ahead of print].
Adult proteocephalid tapeworms of the genus Ophiotaenia (Cestoda: Proteocephalidae) were recovered from the endemic Japanese amphibian species, Pelophylax porosus porosus (Amphibia: Ranidae) from Tochigi, Japan. As a result of molecular analyses based on the 28S ribosomal RNA and cytochrome c oxidase subunit I genes, these worms were identified as Ophiotaenia saphena, a species native to North America. Their morphological features were also consistent with those of O. saphena. This species is presumed to have been introduced into Japan with the American bullfrog, Lithobates catesbeianus (Ranidae). This study presents the first record of O. saphena in Japan and documents a new host record for this species.
Additional Links: PMID-41861986
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41861986,
year = {2026},
author = {Sasaki, M and Ishikawa, T},
title = {First record of the invasive American tapeworm Ophiotaenia saphena (Cestoda: Proteocephalidae) in the Tokyo daruma pond frog Pelophylax porosus porosus in Japan.},
journal = {Parasitology international},
volume = {},
number = {},
pages = {103270},
doi = {10.1016/j.parint.2026.103270},
pmid = {41861986},
issn = {1873-0329},
abstract = {Adult proteocephalid tapeworms of the genus Ophiotaenia (Cestoda: Proteocephalidae) were recovered from the endemic Japanese amphibian species, Pelophylax porosus porosus (Amphibia: Ranidae) from Tochigi, Japan. As a result of molecular analyses based on the 28S ribosomal RNA and cytochrome c oxidase subunit I genes, these worms were identified as Ophiotaenia saphena, a species native to North America. Their morphological features were also consistent with those of O. saphena. This species is presumed to have been introduced into Japan with the American bullfrog, Lithobates catesbeianus (Ranidae). This study presents the first record of O. saphena in Japan and documents a new host record for this species.},
}
RevDate: 2026-03-20
CmpDate: 2026-03-20
Soil, competition, and niche shifts shape the floral mosaic of an annual plant diversity hotspot.
American journal of botany, 113(3):e70171.
PREMISE: Plant species with affinity for harsh substrates often have well-defined edaphic (soil) niches and are ideal for exploring questions of community assembly. Vertic clay soils are chemically and physically challenging to plant establishment and productivity, and annual plant communities associated with these soils of the San Joaquin Desert (California, USA) form a distinctive mosaic pattern of species that reflects differences in soil properties across the landscape.
METHODS: We analyzed soil properties to determine how heterogeneous soils at two field sites in the San Joaquin Desert differed among the realized niches of 12 native annual forb species with an affinity for vertic clay soils. We then conducted a pot study with the same species to test if species differed in their realized and fundamental edaphic niches, and to examine the competition effects of an invasive annual grass (Bromus rubens) on these species' edaphic niches.
RESULTS: From our field study, we found some differences in the vertic clay soils between the realized niches of species at both sites. In our pot study, we found species had similar fundamental edaphic niche optima in our treatment soils and that several species' competitive ability varied with the edaphic stress in our treatment soils. For some species, differences in competitive ability led to shifts in edaphic niche optima, likely contributing to more divergent realized niches.
CONCLUSIONS: The combination of competitive pressure and abiotic stress drove differences between the realized niche and fundamental niche for species in a novel, heterogeneous study system.
Additional Links: PMID-41787697
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41787697,
year = {2026},
author = {Fryer, ER and O'Dell, R and Grossenbacher, DL and Shon, A and McKinnon, S and Rajakaruna, N},
title = {Soil, competition, and niche shifts shape the floral mosaic of an annual plant diversity hotspot.},
journal = {American journal of botany},
volume = {113},
number = {3},
pages = {e70171},
doi = {10.1002/ajb2.70171},
pmid = {41787697},
issn = {1537-2197},
support = {//Torrey Botanical Society/ ; //Garden Club of America/ ; //U.S. Bureau of Land Management/ ; //Frost Summer Undergraduate Research Program/ ; //Northern California Botanists/ ; //Southern California Botanists/ ; //California Botanical Society/ ; //California Native Plant Society/ ; //California Native Plant Society Marin Chapter/ ; //California Native Plant Society Alta Peak Chapter/ ; //California Native Plant Society Santa Clara Valley Chapter/ ; //California Native Plant Society San Luis Obispo Chapter/ ; //College of Science and Mathematics, Cal Poly San Luis Obispo/ ; },
mesh = {*Soil/chemistry ; *Biodiversity ; *Ecosystem ; *Flowers/physiology ; California ; Desert Climate ; *Bromus/physiology ; Introduced Species ; },
abstract = {PREMISE: Plant species with affinity for harsh substrates often have well-defined edaphic (soil) niches and are ideal for exploring questions of community assembly. Vertic clay soils are chemically and physically challenging to plant establishment and productivity, and annual plant communities associated with these soils of the San Joaquin Desert (California, USA) form a distinctive mosaic pattern of species that reflects differences in soil properties across the landscape.
METHODS: We analyzed soil properties to determine how heterogeneous soils at two field sites in the San Joaquin Desert differed among the realized niches of 12 native annual forb species with an affinity for vertic clay soils. We then conducted a pot study with the same species to test if species differed in their realized and fundamental edaphic niches, and to examine the competition effects of an invasive annual grass (Bromus rubens) on these species' edaphic niches.
RESULTS: From our field study, we found some differences in the vertic clay soils between the realized niches of species at both sites. In our pot study, we found species had similar fundamental edaphic niche optima in our treatment soils and that several species' competitive ability varied with the edaphic stress in our treatment soils. For some species, differences in competitive ability led to shifts in edaphic niche optima, likely contributing to more divergent realized niches.
CONCLUSIONS: The combination of competitive pressure and abiotic stress drove differences between the realized niche and fundamental niche for species in a novel, heterogeneous study system.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Soil/chemistry
*Biodiversity
*Ecosystem
*Flowers/physiology
California
Desert Climate
*Bromus/physiology
Introduced Species
RevDate: 2026-03-19
Macroalgal dynamics shape epiphytic foraminiferal assemblages in the eastern Mediterranean rocky reef.
Marine environmental research, 217:107976 pii:S0141-1136(26)00145-5 [Epub ahead of print].
Epiphytism of macroalgae by benthic foraminifera is a common commensal association in rocky intertidal and subtidal reefs. This interaction may be directly and indirectly influenced by climate change and bioinvasions. We investigated this association on rocky reefs of the Eastern Mediterranean Sea, a recognized hotspot of biological invasions and rapid warming, with the aim of establishing a recent baseline of epiphytic foraminiferal dynamics for future monitoring. Epiphytic benthic foraminifera (EBF) attached to macroalgal hosts representing diverse species were collected across seasons and along a very shallow-to-intermediate depth gradient at several rocky reef sites between 2013 and 2017. Macroalgae from all surveyed reefs hosted diverse EBF assemblages composed of both native and alien species. Assemblages were largely dominated by the invasive, endosymbiont-bearing larger benthic foraminifer Amphistegina lobifera, together with native taxa including Pararotalia calcariformata, Textularia agglutinans, and Tretomphalus bulloides. The alien miliolids Sigmamiliolinella australis and Borelis schlumbergeri were recorded alive for the first time in this region, although the latter occurred at low abundances. Algal type and complexity, site, depth, season, and year significantly structured EBF assemblages, whereas no significant differences were detected between sites located inside and outside a marine protected area (MPA). The richest EBF communities occurred on Halopteris scoparia and Laurenciella marilzae, while Dictyota dichotoma and Liagora ceranoides supported the lowest diversity. Spring and summer exhibited the highest richness of larger benthic foraminifera. This study provides a dynamic baseline for epiphytic benthic foraminiferal communities associated with Levantine macroalgae, highlighting increasing invasion dominance and potential responses to ongoing warming.
Additional Links: PMID-41855935
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41855935,
year = {2026},
author = {Hyams-Kaphzan, O and Almogi-Labin, A and Rilov, G and Panov, J and Kitin, M and Herut, B and Golomb, D and Guy-Haim, T},
title = {Macroalgal dynamics shape epiphytic foraminiferal assemblages in the eastern Mediterranean rocky reef.},
journal = {Marine environmental research},
volume = {217},
number = {},
pages = {107976},
doi = {10.1016/j.marenvres.2026.107976},
pmid = {41855935},
issn = {1879-0291},
abstract = {Epiphytism of macroalgae by benthic foraminifera is a common commensal association in rocky intertidal and subtidal reefs. This interaction may be directly and indirectly influenced by climate change and bioinvasions. We investigated this association on rocky reefs of the Eastern Mediterranean Sea, a recognized hotspot of biological invasions and rapid warming, with the aim of establishing a recent baseline of epiphytic foraminiferal dynamics for future monitoring. Epiphytic benthic foraminifera (EBF) attached to macroalgal hosts representing diverse species were collected across seasons and along a very shallow-to-intermediate depth gradient at several rocky reef sites between 2013 and 2017. Macroalgae from all surveyed reefs hosted diverse EBF assemblages composed of both native and alien species. Assemblages were largely dominated by the invasive, endosymbiont-bearing larger benthic foraminifer Amphistegina lobifera, together with native taxa including Pararotalia calcariformata, Textularia agglutinans, and Tretomphalus bulloides. The alien miliolids Sigmamiliolinella australis and Borelis schlumbergeri were recorded alive for the first time in this region, although the latter occurred at low abundances. Algal type and complexity, site, depth, season, and year significantly structured EBF assemblages, whereas no significant differences were detected between sites located inside and outside a marine protected area (MPA). The richest EBF communities occurred on Halopteris scoparia and Laurenciella marilzae, while Dictyota dichotoma and Liagora ceranoides supported the lowest diversity. Spring and summer exhibited the highest richness of larger benthic foraminifera. This study provides a dynamic baseline for epiphytic benthic foraminiferal communities associated with Levantine macroalgae, highlighting increasing invasion dominance and potential responses to ongoing warming.},
}
RevDate: 2026-03-20
Host preference and specialization in the genus Aphanomyces (Oomycetes) from molecular and interaction network insights.
Scientific reports pii:10.1038/s41598-026-44513-5 [Epub ahead of print].
Additional Links: PMID-41857322
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41857322,
year = {2026},
author = {Casabella-Herrero, G and Martín-Torrijos, L and Pérez-Ortega, S and Diéguez-Uribeondo, J},
title = {Host preference and specialization in the genus Aphanomyces (Oomycetes) from molecular and interaction network insights.},
journal = {Scientific reports},
volume = {},
number = {},
pages = {},
doi = {10.1038/s41598-026-44513-5},
pmid = {41857322},
issn = {2045-2322},
}
RevDate: 2026-03-20
CmpDate: 2026-03-20
Presence of nematodes in giant African land snails kept as pets in Poland.
Polish journal of veterinary sciences, 29(1):63-69.
The aim of this study was to assess the presence and identity of nematodes in pet giant African land snails (Lissachatina fulica) in Poland using microscopic and molecular techniques. Lissachatina fulica, syn. Achatina fulica, a giant African land snail is not only considered a free-living invasive species and an intermediate host of some parasites, but is also gaining importance as a pet animal living in close contact with humans. In this research, pooled fecal samples and mucus swabs were obtained from 49 pet giant land snails (11 private collections) living in different regions of Poland. The samples were examined using microscopic techniques (Lugol staining, Baermann larvoscopy) and PCR to investigate the presence of nematodes. The microscopic examinations of fecal samples revealed the presence of nematodes in 63.6% (7/11) of the snail groups. Rhabditid nematodes were found in 27.3% (3/11) of the examined groups. Sequencing of PCR products revealed the presence of gastropod nematodes Phasmarhabditis sp. (KEN1), Poikilolaimus oxycercus and Caenorhabditis nigoni. The genetic material of mammalian parasites, including Crenosoma, was not detected. Given the increasing popularity of L. fulica as pets, understanding their parasitological status is essential for both animal and public health. It also helps meet the expectations of owners who wish to provide proper care for their pet snails.
Additional Links: PMID-41859993
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41859993,
year = {2026},
author = {Piekara-Stępińska, A and Lachowicz-Wolak, A and Piekarska, J and Gorczykowski, M},
title = {Presence of nematodes in giant African land snails kept as pets in Poland.},
journal = {Polish journal of veterinary sciences},
volume = {29},
number = {1},
pages = {63-69},
doi = {10.24425/pjvs.2026.158502},
pmid = {41859993},
issn = {2300-2557},
mesh = {Animals ; Poland/epidemiology ; *Snails/parasitology ; *Nematoda/isolation & purification/classification ; *Pets/parasitology ; Feces/parasitology ; },
abstract = {The aim of this study was to assess the presence and identity of nematodes in pet giant African land snails (Lissachatina fulica) in Poland using microscopic and molecular techniques. Lissachatina fulica, syn. Achatina fulica, a giant African land snail is not only considered a free-living invasive species and an intermediate host of some parasites, but is also gaining importance as a pet animal living in close contact with humans. In this research, pooled fecal samples and mucus swabs were obtained from 49 pet giant land snails (11 private collections) living in different regions of Poland. The samples were examined using microscopic techniques (Lugol staining, Baermann larvoscopy) and PCR to investigate the presence of nematodes. The microscopic examinations of fecal samples revealed the presence of nematodes in 63.6% (7/11) of the snail groups. Rhabditid nematodes were found in 27.3% (3/11) of the examined groups. Sequencing of PCR products revealed the presence of gastropod nematodes Phasmarhabditis sp. (KEN1), Poikilolaimus oxycercus and Caenorhabditis nigoni. The genetic material of mammalian parasites, including Crenosoma, was not detected. Given the increasing popularity of L. fulica as pets, understanding their parasitological status is essential for both animal and public health. It also helps meet the expectations of owners who wish to provide proper care for their pet snails.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
Poland/epidemiology
*Snails/parasitology
*Nematoda/isolation & purification/classification
*Pets/parasitology
Feces/parasitology
RevDate: 2026-03-20
CmpDate: 2026-03-20
Increasing Functional or Phylogenetic Distance From Native Fish Communities Promotes Non-Native Fish Invasions in Global Rivers.
Global change biology, 32(3):e70814.
Biological invasions severely threaten ecosystems and their underlying drivers remain a subject of ongoing inquiry in ecology. Four mutually exclusive invasion hypotheses, biotic acceptance and resistance hypotheses and Darwin's preadaptation and naturalization hypotheses, have long drawn extensive attention. Furthermore, human activities and environmental factors are also widely recognized as key drivers of biological invasions. While integrative analyses of the aforementioned biotic and abiotic factors influencing biological invasions have been conducted previously, systematic global-scale analyses for freshwater fishes remain limited, constraining our understanding of large-scale invasion patterns in this taxon. Here, we leveraged a comprehensive database with taxonomic, functional, and phylogenetic data for 5245 freshwater fish species across 1411 global river basins to explore ecological correlates of non-native fish establishment. Specifically, we used taxonomic, functional, and phylogenetic facets of biodiversity to comprehensively quantify native communities (testing biotic acceptance and resistance hypotheses) and relatedness between native and non-native communities (testing Darwin's preadaptation and naturalization hypotheses). We further extracted environmental and anthropogenic variables across global rivers to assess external predictors of non-native fish establishment. Our results primarily supported Darwin's naturalization hypothesis: at the global level, native fish community invasibility peaked when non-native species exhibited great functional or phylogenetic distance from native communities, suggesting distantly related non-natives likely had unique traits or strategies to exploit vacant niches. Meanwhile, climatic factors also emerged as key drivers of global fish invasion patterns. At the biogeographic realm level, the determinants of fish invasions varied among the six realms, highlighting the complexity and regional specificity of biological invasions. However, our findings were based on correlational patterns of established non-native species at the basin scale and thus cannot establish definitive causal relationships between the identified drivers and establishment success. Future experimental manipulations at finer spatial and temporal scales are therefore required to validate the correlations observed in this study.
Additional Links: PMID-41860114
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41860114,
year = {2026},
author = {Xiang, T and Arranz, I and Kuczynski, L and Zeng, Q and Mao, Z and Gu, X and Grenouillet, G},
title = {Increasing Functional or Phylogenetic Distance From Native Fish Communities Promotes Non-Native Fish Invasions in Global Rivers.},
journal = {Global change biology},
volume = {32},
number = {3},
pages = {e70814},
doi = {10.1111/gcb.70814},
pmid = {41860114},
issn = {1365-2486},
support = {BK20241696//Basic Research Program of Jiangsu Province/ ; GZC20241787//Postdoctoral Fellowship Program of CPSF/ ; 2024ZB592//Jiangsu Funding Program for Excellent Postdoctoral Talent/ ; 32501560//National Natural Science Foundation of China/ ; 32071575//National Natural Science Foundation of China/ ; 32471649//National Natural Science Foundation of China/ ; NKL2023-KP02//Key Laboratory of Lake and Watershed Science for Water Security/ ; 848/26-1//German Science Foundation funded research unit DynaCom/ ; 2022T1/AMB-24100//Programa Atracción del Talento/ ; ANR-10-LABX-0025//Investissement d'Avenir/ ; ANR-10-LABX-41//Investissement d'Avenir/ ; },
mesh = {Animals ; *Introduced Species ; *Fishes/physiology/classification ; *Rivers ; *Phylogeny ; *Biodiversity ; Ecosystem ; },
abstract = {Biological invasions severely threaten ecosystems and their underlying drivers remain a subject of ongoing inquiry in ecology. Four mutually exclusive invasion hypotheses, biotic acceptance and resistance hypotheses and Darwin's preadaptation and naturalization hypotheses, have long drawn extensive attention. Furthermore, human activities and environmental factors are also widely recognized as key drivers of biological invasions. While integrative analyses of the aforementioned biotic and abiotic factors influencing biological invasions have been conducted previously, systematic global-scale analyses for freshwater fishes remain limited, constraining our understanding of large-scale invasion patterns in this taxon. Here, we leveraged a comprehensive database with taxonomic, functional, and phylogenetic data for 5245 freshwater fish species across 1411 global river basins to explore ecological correlates of non-native fish establishment. Specifically, we used taxonomic, functional, and phylogenetic facets of biodiversity to comprehensively quantify native communities (testing biotic acceptance and resistance hypotheses) and relatedness between native and non-native communities (testing Darwin's preadaptation and naturalization hypotheses). We further extracted environmental and anthropogenic variables across global rivers to assess external predictors of non-native fish establishment. Our results primarily supported Darwin's naturalization hypothesis: at the global level, native fish community invasibility peaked when non-native species exhibited great functional or phylogenetic distance from native communities, suggesting distantly related non-natives likely had unique traits or strategies to exploit vacant niches. Meanwhile, climatic factors also emerged as key drivers of global fish invasion patterns. At the biogeographic realm level, the determinants of fish invasions varied among the six realms, highlighting the complexity and regional specificity of biological invasions. However, our findings were based on correlational patterns of established non-native species at the basin scale and thus cannot establish definitive causal relationships between the identified drivers and establishment success. Future experimental manipulations at finer spatial and temporal scales are therefore required to validate the correlations observed in this study.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Introduced Species
*Fishes/physiology/classification
*Rivers
*Phylogeny
*Biodiversity
Ecosystem
RevDate: 2026-03-20
CmpDate: 2026-03-20
Global Patterns of Niche Changes in Alien Mammals: Potential Drivers and Significance for Invasion Projections.
Global change biology, 32(3):e70755.
Biological invasions are a major driver of global change, and prevention is the most effective mitigation strategy. Bioclimatic species distribution models (SDMs) are widely used to estimate invasion risk, assuming that species retain their realized native climatic niches after introduction. We tested this assumption for 194 alien mammal species established across 11 zoogeographic realms, examining realized niche changes, their drivers, and significance for invasion projections. We used a robust ordination framework to compare native and alien niches in 337 species-by-realm niche comparisons and quantify niche expansion, the proportion of the alien niche not overlapping with the native niche, and niche unfilling, the proportion of the native niche not overlapping with the alien niche. We then applied Generalized Linear Mixed Models (GLMMs) with multi-model inference to test how species attributes, invasion history, and environmental context are associated with expansion and unfilling. Additionally, we evaluated the transferability of SDMs built on native presences to receiving regions using multiple metrics and used GLMMs to assess how niche changes may affect it. Niche expansion was rare and modest, whereas niche unfilling was common and pronounced. Niche expansion declined with increasing human disturbance, larger native range size, and introductions within similar communities, but increased with higher introduction effort. Niche unfilling decreased with greater introduction effort and longer residence time, but increased with alien insularity, human disturbance, and native range loss. SDM transferability was generally good, but it declined with niche expansion, as alien presences fell outside native-like suitable areas, and with unfilling, because suitable areas remained unoccupied under colonization lags. Proactive management can rely on SDMs to anticipate future spread and should prioritize species showing high niche unfilling, indicating substantial spread potential, and any evidence of niche expansion, which makes spread harder to anticipate.
Additional Links: PMID-41860462
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41860462,
year = {2026},
author = {Biancolini, D and Broennimann, O and Guisan, A and Rondinini, C},
title = {Global Patterns of Niche Changes in Alien Mammals: Potential Drivers and Significance for Invasion Projections.},
journal = {Global change biology},
volume = {32},
number = {3},
pages = {e70755},
doi = {10.1111/gcb.70755},
pmid = {41860462},
issn = {1365-2486},
support = {//Sapienza Università di Roma/ ; },
mesh = {Animals ; *Introduced Species ; *Mammals/physiology ; *Ecosystem ; *Animal Distribution ; Climate Change ; Models, Biological ; },
abstract = {Biological invasions are a major driver of global change, and prevention is the most effective mitigation strategy. Bioclimatic species distribution models (SDMs) are widely used to estimate invasion risk, assuming that species retain their realized native climatic niches after introduction. We tested this assumption for 194 alien mammal species established across 11 zoogeographic realms, examining realized niche changes, their drivers, and significance for invasion projections. We used a robust ordination framework to compare native and alien niches in 337 species-by-realm niche comparisons and quantify niche expansion, the proportion of the alien niche not overlapping with the native niche, and niche unfilling, the proportion of the native niche not overlapping with the alien niche. We then applied Generalized Linear Mixed Models (GLMMs) with multi-model inference to test how species attributes, invasion history, and environmental context are associated with expansion and unfilling. Additionally, we evaluated the transferability of SDMs built on native presences to receiving regions using multiple metrics and used GLMMs to assess how niche changes may affect it. Niche expansion was rare and modest, whereas niche unfilling was common and pronounced. Niche expansion declined with increasing human disturbance, larger native range size, and introductions within similar communities, but increased with higher introduction effort. Niche unfilling decreased with greater introduction effort and longer residence time, but increased with alien insularity, human disturbance, and native range loss. SDM transferability was generally good, but it declined with niche expansion, as alien presences fell outside native-like suitable areas, and with unfilling, because suitable areas remained unoccupied under colonization lags. Proactive management can rely on SDMs to anticipate future spread and should prioritize species showing high niche unfilling, indicating substantial spread potential, and any evidence of niche expansion, which makes spread harder to anticipate.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Introduced Species
*Mammals/physiology
*Ecosystem
*Animal Distribution
Climate Change
Models, Biological
RevDate: 2026-03-18
The phylogenetic diversity of plant communities in response to anthropogenic disturbances in a Neotropical savanna.
Annals of botany pii:8527020 [Epub ahead of print].
Traditional assessments of human impact on ecological communities often focus on species richness and abundance, without considering the evolutionary relationship between species. This study evaluated how anthropogenic disturbances, notably those favoring invasive species, alter the phylogenetic diversity and structure of plant communities in the Cerrado, a global biodiversity hotspot. We compared alpha and beta phylogenetic diversity and structure (using PD, SES PD, SES MPD and SES MNTD) in plant communities from 11 roadside sites, characterized by high densities of exotic species, with 10 conservation areas (reserves), where exotic species occur at much lower densities. Phylogenetic metrics were calculated using data from the entire community or from native species only. Phylogenetic richness (PD) was consistently lower in roadside communities than in reserves, reflecting reduced species richness under chronic disturbance. In contrast, standardized phylogenetic richness (SES-PD) did not differ between habitats, indicating that roadside communities retain a broad representation of native evolutionary lineages. Differences in phylogenetic structure emerged only when exotic species were included in the analysis and, in this case, roadside communities exhibited phylogenetic clustering at both deep and terminal evolutionary levels, whereas reserve communities showed a random phylogenetic structure. Similarly, differences in phylogenetic dissimilarity between roadside and reserve communities were detected only when data from exotic species were included in the analysis. In this case, evidence of phylogenetic homogenization in roadside communities was detected, and this was probably associated with the much greater abundance of invasive grasses in this than in the protected habitats. Overall, our findings indicate that chronic disturbance is associated with phylogenetic homogenization in Cerrado plant communities, particularly in habitats dominated by invasive grasses. We suggest that protected areas play a crucial role in preserving phylogenetic diversity, especially for disturbance-sensitive clades. Accordingly, maintaining and expanding reserves, safeguarding remnant habitats, and managing biological invasions within disturbed landscapes are key strategies for conserving the evolutionary heritage and biodiversity of the Cerrado savanna biome.
Additional Links: PMID-41845177
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41845177,
year = {2026},
author = {Altomare, M and Bruna, EM and Ferreira Neves, KC and Borges, ER and Menor, IO and Afonso do Prado Júnior, J and Vasconcelos, HL},
title = {The phylogenetic diversity of plant communities in response to anthropogenic disturbances in a Neotropical savanna.},
journal = {Annals of botany},
volume = {},
number = {},
pages = {},
doi = {10.1093/aob/mcag058},
pmid = {41845177},
issn = {1095-8290},
abstract = {Traditional assessments of human impact on ecological communities often focus on species richness and abundance, without considering the evolutionary relationship between species. This study evaluated how anthropogenic disturbances, notably those favoring invasive species, alter the phylogenetic diversity and structure of plant communities in the Cerrado, a global biodiversity hotspot. We compared alpha and beta phylogenetic diversity and structure (using PD, SES PD, SES MPD and SES MNTD) in plant communities from 11 roadside sites, characterized by high densities of exotic species, with 10 conservation areas (reserves), where exotic species occur at much lower densities. Phylogenetic metrics were calculated using data from the entire community or from native species only. Phylogenetic richness (PD) was consistently lower in roadside communities than in reserves, reflecting reduced species richness under chronic disturbance. In contrast, standardized phylogenetic richness (SES-PD) did not differ between habitats, indicating that roadside communities retain a broad representation of native evolutionary lineages. Differences in phylogenetic structure emerged only when exotic species were included in the analysis and, in this case, roadside communities exhibited phylogenetic clustering at both deep and terminal evolutionary levels, whereas reserve communities showed a random phylogenetic structure. Similarly, differences in phylogenetic dissimilarity between roadside and reserve communities were detected only when data from exotic species were included in the analysis. In this case, evidence of phylogenetic homogenization in roadside communities was detected, and this was probably associated with the much greater abundance of invasive grasses in this than in the protected habitats. Overall, our findings indicate that chronic disturbance is associated with phylogenetic homogenization in Cerrado plant communities, particularly in habitats dominated by invasive grasses. We suggest that protected areas play a crucial role in preserving phylogenetic diversity, especially for disturbance-sensitive clades. Accordingly, maintaining and expanding reserves, safeguarding remnant habitats, and managing biological invasions within disturbed landscapes are key strategies for conserving the evolutionary heritage and biodiversity of the Cerrado savanna biome.},
}
RevDate: 2026-03-19
CmpDate: 2026-03-19
Editorial: Women in environmental microbiomes.
Frontiers in microbiomes, 4:1537069.
Additional Links: PMID-41852397
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41852397,
year = {2025},
author = {Mueller, RC and Gehring, CA},
title = {Editorial: Women in environmental microbiomes.},
journal = {Frontiers in microbiomes},
volume = {4},
number = {},
pages = {1537069},
pmid = {41852397},
issn = {2813-4338},
}
RevDate: 2026-03-19
CmpDate: 2026-03-19
An updated herpetological inventory of the Agusan Marsh Wildlife Sanctuary, eastern Mindanao Island, Philippines.
ZooKeys, 1272:203-251.
A formal synthesis of the occurrence of herpetofauna species in Agusan Marsh Wildlife Sanctuary remained scant since the documentation of historical records by E.H. Taylor in the early 20[th] century. Here, an updated checklist of the Agusan Marsh herpetofauna is provided. 49 species (16 amphibians and 33 reptiles) are recorded from the Agusan Marsh's peat and freshwater swamp forests, specifically, amphibians in the families Bufonidae, Ceratobatrachidae, Dicroglossidae, Microhylidae, Megophryidae, Ranidae, and Rhacophoridae; lizards in the families Agamidae, Gekkonidae, Dibamidae, Scincidae, and Varanidae; snakes in the families Colubridae, Cyclocoridae, Psammodynastidae, Pareidae, Pythonidae, Typhlopidae, and Viperidae; and a turtle in the family Geoemydidae. Our Shannon Diversity Indices calculations suggest that diversity might be declining, but more surveys are needed to sample the total species richness of the Agusan Marsh Wildlife Sanctuary. Our checklist highlights 14 new records (6 amphibians, 8 reptiles) and the presence of four invasive alien species in Agusan Marsh. Given the tremendous historical significance of the region, Agusan Marsh may represent one of the most significant focal study sites for assessing the impacts of historical land use and climate change in the Philippines. This work also demonstrates the importance of temporally sequential survey-resurveys for updating baseline biodiversity data to inform management decisions and conservation actions for this unique wetland ecosystem in Southeast Asia.
Additional Links: PMID-41853458
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41853458,
year = {2026},
author = {Sanguila, MB and Labaja, ACO and Bernstein, JM and Brown, RM},
title = {An updated herpetological inventory of the Agusan Marsh Wildlife Sanctuary, eastern Mindanao Island, Philippines.},
journal = {ZooKeys},
volume = {1272},
number = {},
pages = {203-251},
pmid = {41853458},
issn = {1313-2989},
abstract = {A formal synthesis of the occurrence of herpetofauna species in Agusan Marsh Wildlife Sanctuary remained scant since the documentation of historical records by E.H. Taylor in the early 20[th] century. Here, an updated checklist of the Agusan Marsh herpetofauna is provided. 49 species (16 amphibians and 33 reptiles) are recorded from the Agusan Marsh's peat and freshwater swamp forests, specifically, amphibians in the families Bufonidae, Ceratobatrachidae, Dicroglossidae, Microhylidae, Megophryidae, Ranidae, and Rhacophoridae; lizards in the families Agamidae, Gekkonidae, Dibamidae, Scincidae, and Varanidae; snakes in the families Colubridae, Cyclocoridae, Psammodynastidae, Pareidae, Pythonidae, Typhlopidae, and Viperidae; and a turtle in the family Geoemydidae. Our Shannon Diversity Indices calculations suggest that diversity might be declining, but more surveys are needed to sample the total species richness of the Agusan Marsh Wildlife Sanctuary. Our checklist highlights 14 new records (6 amphibians, 8 reptiles) and the presence of four invasive alien species in Agusan Marsh. Given the tremendous historical significance of the region, Agusan Marsh may represent one of the most significant focal study sites for assessing the impacts of historical land use and climate change in the Philippines. This work also demonstrates the importance of temporally sequential survey-resurveys for updating baseline biodiversity data to inform management decisions and conservation actions for this unique wetland ecosystem in Southeast Asia.},
}
RevDate: 2026-03-19
CmpDate: 2026-03-19
Utilizing symbiotic relationships and assisted migration in restoration to cope with multiple stressors, and the legacy of invasive species.
Frontiers in microbiomes, 3:1331341.
INTRODUCTION: Climate change has increased the need for forest restoration, but low planting success and limited availability of planting materials hamper these efforts. Invasive plants and their soil legacies can further reduce restoration success. Thus, strategies that optimize restoration are crucial. Assisted migration and inoculation with native microbial symbiont communities have great potential to increase restoration success. However, assisted migrants can still show reduced survival compared to local provenances depending on transfer distance. Inoculation with mycorrhizal fungi, effective if well-matched to plants and site conditions, can have neutral to negative results with poor pairings. Few studies have examined the interaction between these two strategies in realistic field environments where native plants experience the combined effects of soil legacies left by invasive plants and the drought conditions that result from a warming, drying climate.
METHODS: We planted two ecotypes (local climate and warmer climate) of Populus fremontii (Fremont cottonwoods), in soils with and without legacies of invasion by Tamarix spp. (tamarisk), and with and without addition of native mycorrhizal fungi and other soil biota from the warmer climate.
RESULTS: Four main results emerged. 1) First year survival in soil legacies left behind after tamarisk invasion and removal was less than one tenth of survival in soil without a tamarisk legacy. 2) Actively restoring soil communities after tamarisk removal tripled first year cottonwood survival for both ecotypes, but only improved survival of the warmer, assisted migrant ecotype trees in year two. 3) Actively restoring soil communities in areas without a tamarisk history reduced first year survival for both ecotypes, but improved survival of the warmer, assisted migrant ecotype trees in year two. 4) By the second year, inoculated assisted migrants survived at five times the rate of inoculated trees from the local ecotype.
DISCUSSION: Results emphasize the detrimental effects of soil legacies left after tamarisk invasion and removal, the efficacy of assisted migration and restoring soil communities alongside plants, and the need to thoughtfully optimize pairings between plants, fungi, and site conditions.
Additional Links: PMID-41853536
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41853536,
year = {2024},
author = {Markovchick, LM and Belgara-Andrew, A and Richard, D and Deringer, T and Grady, KC and Hultine, KR and Allan, GJ and Whitham, TG and Querejeta, JI and Gehring, CA},
title = {Utilizing symbiotic relationships and assisted migration in restoration to cope with multiple stressors, and the legacy of invasive species.},
journal = {Frontiers in microbiomes},
volume = {3},
number = {},
pages = {1331341},
pmid = {41853536},
issn = {2813-4338},
abstract = {INTRODUCTION: Climate change has increased the need for forest restoration, but low planting success and limited availability of planting materials hamper these efforts. Invasive plants and their soil legacies can further reduce restoration success. Thus, strategies that optimize restoration are crucial. Assisted migration and inoculation with native microbial symbiont communities have great potential to increase restoration success. However, assisted migrants can still show reduced survival compared to local provenances depending on transfer distance. Inoculation with mycorrhizal fungi, effective if well-matched to plants and site conditions, can have neutral to negative results with poor pairings. Few studies have examined the interaction between these two strategies in realistic field environments where native plants experience the combined effects of soil legacies left by invasive plants and the drought conditions that result from a warming, drying climate.
METHODS: We planted two ecotypes (local climate and warmer climate) of Populus fremontii (Fremont cottonwoods), in soils with and without legacies of invasion by Tamarix spp. (tamarisk), and with and without addition of native mycorrhizal fungi and other soil biota from the warmer climate.
RESULTS: Four main results emerged. 1) First year survival in soil legacies left behind after tamarisk invasion and removal was less than one tenth of survival in soil without a tamarisk legacy. 2) Actively restoring soil communities after tamarisk removal tripled first year cottonwood survival for both ecotypes, but only improved survival of the warmer, assisted migrant ecotype trees in year two. 3) Actively restoring soil communities in areas without a tamarisk history reduced first year survival for both ecotypes, but improved survival of the warmer, assisted migrant ecotype trees in year two. 4) By the second year, inoculated assisted migrants survived at five times the rate of inoculated trees from the local ecotype.
DISCUSSION: Results emphasize the detrimental effects of soil legacies left after tamarisk invasion and removal, the efficacy of assisted migration and restoring soil communities alongside plants, and the need to thoughtfully optimize pairings between plants, fungi, and site conditions.},
}
RevDate: 2026-03-19
Reproductive plasticity and environmental tolerance of invasive African catfish (Clarias gariepinus) in a tropical Brazilian river.
Journal of fish biology [Epub ahead of print].
Invasive alien species (IAS) pose a significant threat to biodiversity, particularly when endowed with high ecological and reproductive plasticity. The African catfish, Clarias gariepinus, is one such species, widely recognized for its ability to colonize and establish in diverse tropical ecosystems. This study evaluated the reproductive success of C. gariepinus in a tropical environment by examining gonadal maturation stages, reproductive indices and water physicochemical variables associated with reproduction. The analysis revealed a population predominantly composed of adult individuals at various reproductive stages, with a higher concentration upstream during the dry season. The species exhibited continuous reproduction throughout the year, irrespective of body size, demonstrating both high fecundity and notable environmental flexibility. Dobriyal's Reproductivity Index (DI) proved effective in identifying gonadal maturation patterns independently of somatic size and is particularly useful under conditions of limited sampling. Statistical analyses revealed a strong association between DI and key physicochemical parameters (i.e., particularly elevated dissolved oxygen concentrations and pH values within optimal ranges) which collectively influence species distribution and reproductive success. These findings underscore reproductive plasticity and environmental tolerance as pivotal strategies underpinning the invasive potential of African catfish in tropical systems. We conclude that ongoing monitoring and targeted management interventions are crucial for mitigating the ecological impacts of C. gariepinus and alleviating pressure on native fish communities.
Additional Links: PMID-41854024
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41854024,
year = {2026},
author = {Dumith, MT and Dos Santos, AFGN},
title = {Reproductive plasticity and environmental tolerance of invasive African catfish (Clarias gariepinus) in a tropical Brazilian river.},
journal = {Journal of fish biology},
volume = {},
number = {},
pages = {},
doi = {10.1111/jfb.70389},
pmid = {41854024},
issn = {1095-8649},
support = {//Coordenação de Aperfeiçoamento de Pessoal de Nível Superior/ ; 405984/2016-2//Conselho Nacional de Desenvolvimento Científico e Tecnológico/ ; },
abstract = {Invasive alien species (IAS) pose a significant threat to biodiversity, particularly when endowed with high ecological and reproductive plasticity. The African catfish, Clarias gariepinus, is one such species, widely recognized for its ability to colonize and establish in diverse tropical ecosystems. This study evaluated the reproductive success of C. gariepinus in a tropical environment by examining gonadal maturation stages, reproductive indices and water physicochemical variables associated with reproduction. The analysis revealed a population predominantly composed of adult individuals at various reproductive stages, with a higher concentration upstream during the dry season. The species exhibited continuous reproduction throughout the year, irrespective of body size, demonstrating both high fecundity and notable environmental flexibility. Dobriyal's Reproductivity Index (DI) proved effective in identifying gonadal maturation patterns independently of somatic size and is particularly useful under conditions of limited sampling. Statistical analyses revealed a strong association between DI and key physicochemical parameters (i.e., particularly elevated dissolved oxygen concentrations and pH values within optimal ranges) which collectively influence species distribution and reproductive success. These findings underscore reproductive plasticity and environmental tolerance as pivotal strategies underpinning the invasive potential of African catfish in tropical systems. We conclude that ongoing monitoring and targeted management interventions are crucial for mitigating the ecological impacts of C. gariepinus and alleviating pressure on native fish communities.},
}
RevDate: 2026-03-19
CmpDate: 2026-03-19
Integrating biological and machine learning models for rainbow trout growth: Balancing accuracy and interpretability.
PloS one, 21(3):e0336890 pii:PONE-D-25-59069.
Invasive species management demands predictive models that balance accuracy with ecological interpretability, yet traditional approaches often fail to capture complex environmental interactions. We evaluated hybrid frameworks integrating biological and machine learning models for rainbow trout (Oncorhynchus mykiss) growth in the Lower Colorado River using ten years of tag-recapture data and environmental covariates, comparing traditional and Bayesian von Bertalanffy (VBGM) and Gompertz models with Random Forests, XGBoost, LightGBM, Support Vector Regression, Neural Networks, and ensemble methods through probabilistic performance analysis. Incorporating environmental context and advanced modeling produced substantial gains, with top methods achieving 70-80 percent error reductions relative to baseline models, equivalent to 45-70 mm or 20-32 percent of mean fish length. A stacked ensemble of XGBoost and the VBGM achieved the best performance (RMSE = 15.96 mm, [Formula: see text]) and exhibited stochastic dominance across the posterior, while gradient boosting models formed a strong second tier, led by LightGBM and XGBoost. Bayesian Model Averaging reached comparable accuracy while explicitly quantifying uncertainty. Even traditional mechanistic models improved by up to 80 percent when enhanced with covariates and Bayesian estimation, preserving biological interpretability through parameters such as asymptotic size and growth rate. Feature importance analysis identified initial length, time at large, and weight at release as dominant predictors, and the stacked ensemble outperformed baseline models in over 99 percent of posterior samples. These results establish hybrid ensemble frameworks as powerful tools for ecological forecasting that unite predictive performance with mechanistic insight, providing a generalizable template for systems where both accuracy and interpretability are required.
Additional Links: PMID-41855217
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41855217,
year = {2026},
author = {Fulton, L and Lyu, P},
title = {Integrating biological and machine learning models for rainbow trout growth: Balancing accuracy and interpretability.},
journal = {PloS one},
volume = {21},
number = {3},
pages = {e0336890},
doi = {10.1371/journal.pone.0336890},
pmid = {41855217},
issn = {1932-6203},
mesh = {Animals ; *Oncorhynchus mykiss/growth & development ; *Machine Learning ; Bayes Theorem ; *Models, Biological ; Rivers ; Introduced Species ; },
abstract = {Invasive species management demands predictive models that balance accuracy with ecological interpretability, yet traditional approaches often fail to capture complex environmental interactions. We evaluated hybrid frameworks integrating biological and machine learning models for rainbow trout (Oncorhynchus mykiss) growth in the Lower Colorado River using ten years of tag-recapture data and environmental covariates, comparing traditional and Bayesian von Bertalanffy (VBGM) and Gompertz models with Random Forests, XGBoost, LightGBM, Support Vector Regression, Neural Networks, and ensemble methods through probabilistic performance analysis. Incorporating environmental context and advanced modeling produced substantial gains, with top methods achieving 70-80 percent error reductions relative to baseline models, equivalent to 45-70 mm or 20-32 percent of mean fish length. A stacked ensemble of XGBoost and the VBGM achieved the best performance (RMSE = 15.96 mm, [Formula: see text]) and exhibited stochastic dominance across the posterior, while gradient boosting models formed a strong second tier, led by LightGBM and XGBoost. Bayesian Model Averaging reached comparable accuracy while explicitly quantifying uncertainty. Even traditional mechanistic models improved by up to 80 percent when enhanced with covariates and Bayesian estimation, preserving biological interpretability through parameters such as asymptotic size and growth rate. Feature importance analysis identified initial length, time at large, and weight at release as dominant predictors, and the stacked ensemble outperformed baseline models in over 99 percent of posterior samples. These results establish hybrid ensemble frameworks as powerful tools for ecological forecasting that unite predictive performance with mechanistic insight, providing a generalizable template for systems where both accuracy and interpretability are required.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Oncorhynchus mykiss/growth & development
*Machine Learning
Bayes Theorem
*Models, Biological
Rivers
Introduced Species
RevDate: 2026-03-19
CmpDate: 2026-03-19
Evolution of Threespine Stickleback (Gasterosteus aculeatus) Defensive Traits following the Stocking of Brook Trout (Salvelinus fontinalis).
The American naturalist, 207(4):590-597.
AbstractIn recent decades, numerous observations have been made of evolution induced by anthropogenic change in natural populations. Evolution in response to harvest, climate change, pollution, landscape change, and introduced invasive species are common. Here, we provide evidence for evolution in a new context by documenting a large increase in the frequency of defensive pelvic spines in two unusual threespine stickleback (Gasterosteus aculeatus) populations previously shown to mostly lack such structures. These populations, in Parc national du Lac-Témiscouata, Québec, Canada, were historically free of predatory fish and consisted nearly entirely of pelvic-spineless stickleback. This phenotypic change coincided with the stocking of the lakes with brook trout (Salvelinus fontinalis), a stickleback predator, and the introductions of other species used by anglers as live bait. The rapid evolutionary change toward a more defensive morph in the populations should prompt increased caution regarding the effects of management practices on native species.
Additional Links: PMID-41855518
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41855518,
year = {2026},
author = {Haines, GE and Sanderson, S and Morin-Nadeau, R and Hendry, AP},
title = {Evolution of Threespine Stickleback (Gasterosteus aculeatus) Defensive Traits following the Stocking of Brook Trout (Salvelinus fontinalis).},
journal = {The American naturalist},
volume = {207},
number = {4},
pages = {590-597},
doi = {10.1086/739174},
pmid = {41855518},
issn = {1537-5323},
mesh = {Animals ; *Trout/physiology ; *Smegmamorpha/anatomy & histology/physiology/genetics ; *Biological Evolution ; Quebec ; Introduced Species ; Lakes ; Phenotype ; Female ; },
abstract = {AbstractIn recent decades, numerous observations have been made of evolution induced by anthropogenic change in natural populations. Evolution in response to harvest, climate change, pollution, landscape change, and introduced invasive species are common. Here, we provide evidence for evolution in a new context by documenting a large increase in the frequency of defensive pelvic spines in two unusual threespine stickleback (Gasterosteus aculeatus) populations previously shown to mostly lack such structures. These populations, in Parc national du Lac-Témiscouata, Québec, Canada, were historically free of predatory fish and consisted nearly entirely of pelvic-spineless stickleback. This phenotypic change coincided with the stocking of the lakes with brook trout (Salvelinus fontinalis), a stickleback predator, and the introductions of other species used by anglers as live bait. The rapid evolutionary change toward a more defensive morph in the populations should prompt increased caution regarding the effects of management practices on native species.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Trout/physiology
*Smegmamorpha/anatomy & histology/physiology/genetics
*Biological Evolution
Quebec
Introduced Species
Lakes
Phenotype
Female
RevDate: 2026-03-17
CmpDate: 2026-03-17
Water pollution drives environmental degradation in a seasonally influenced Neotropical coastal river.
Environmental monitoring and assessment, 198(4):.
Aquatic and coastal ecosystems are increasingly altered by human activities, particularly through the removal of riparian vegetation, pollution, urbanization, and biological invasions. This study aimed to assess environmental conditions and identify a gradient of human disturbance in the Guaraguaçu River, located on the coastal plain of southern Brazil and subjected to multiple stressors. To achieve this, we evaluated land use, water and sediment quality, and the dominance of invasive macrophytes, and applied a rapid physical habitat assessment protocol quarterly throughout 2024 at 22 sites along the main channel of the Guaraguaçu River and its two tributaries, the Pery and Pombas Rivers. Data were summarized using principal coordinate analysis (PCoA), and the axis scores were used to define the environmental gradient. The results revealed a clear gradient in environmental conditions, likely driven by anthropogenic pressures across the watershed. Among the various stressors analyzed, water pollution emerged as the primary driver of environmental degradation in the Guaraguaçu River Basin. Conductivity, salinity, ammonia, and orthophosphate contributed most significantly to the observed gradient. The highest values for these parameters were recorded in the Pery River and downstream from its confluence with the Guaraguaçu River, indicating a decline in environmental quality in this tributary and, consequently, in the lower basin sector. The results showed that environmental conditions varied along a gradient significantly influenced by both seasonality and river zone, suggesting that seasonal dynamics are a key driver of this pattern. This influence of seasonality was also supported by the PCoA results, which reflected clear temporal patterns in environmental variability. Furthermore, human-induced changes to the Pery River, particularly water pollution and hydrological modifications, have impaired ecological conditions and intensified environmental degradation in downstream areas of the Guaraguaçu River basin. These findings highlight the need for targeted management strategies, including improved wastewater treatment, to mitigate cumulative stressors and enhance the resilience of this coastal river ecosystem.
Additional Links: PMID-41840120
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41840120,
year = {2026},
author = {da S Belanha, L and Paz, OLS and Padial, AA and de Azevedo, JCR and Hughes, RM and Ruaro, R},
title = {Water pollution drives environmental degradation in a seasonally influenced Neotropical coastal river.},
journal = {Environmental monitoring and assessment},
volume = {198},
number = {4},
pages = {},
pmid = {41840120},
issn = {1573-2959},
mesh = {*Rivers/chemistry ; *Environmental Monitoring ; Brazil ; *Water Pollution/statistics & numerical data ; Ecosystem ; Seasons ; Water Pollutants, Chemical/analysis ; },
abstract = {Aquatic and coastal ecosystems are increasingly altered by human activities, particularly through the removal of riparian vegetation, pollution, urbanization, and biological invasions. This study aimed to assess environmental conditions and identify a gradient of human disturbance in the Guaraguaçu River, located on the coastal plain of southern Brazil and subjected to multiple stressors. To achieve this, we evaluated land use, water and sediment quality, and the dominance of invasive macrophytes, and applied a rapid physical habitat assessment protocol quarterly throughout 2024 at 22 sites along the main channel of the Guaraguaçu River and its two tributaries, the Pery and Pombas Rivers. Data were summarized using principal coordinate analysis (PCoA), and the axis scores were used to define the environmental gradient. The results revealed a clear gradient in environmental conditions, likely driven by anthropogenic pressures across the watershed. Among the various stressors analyzed, water pollution emerged as the primary driver of environmental degradation in the Guaraguaçu River Basin. Conductivity, salinity, ammonia, and orthophosphate contributed most significantly to the observed gradient. The highest values for these parameters were recorded in the Pery River and downstream from its confluence with the Guaraguaçu River, indicating a decline in environmental quality in this tributary and, consequently, in the lower basin sector. The results showed that environmental conditions varied along a gradient significantly influenced by both seasonality and river zone, suggesting that seasonal dynamics are a key driver of this pattern. This influence of seasonality was also supported by the PCoA results, which reflected clear temporal patterns in environmental variability. Furthermore, human-induced changes to the Pery River, particularly water pollution and hydrological modifications, have impaired ecological conditions and intensified environmental degradation in downstream areas of the Guaraguaçu River basin. These findings highlight the need for targeted management strategies, including improved wastewater treatment, to mitigate cumulative stressors and enhance the resilience of this coastal river ecosystem.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Rivers/chemistry
*Environmental Monitoring
Brazil
*Water Pollution/statistics & numerical data
Ecosystem
Seasons
Water Pollutants, Chemical/analysis
RevDate: 2026-03-17
CmpDate: 2026-03-17
Wild cucumber invasiveness: impact of seasonal changes on biometric seed traits and dispersal strategy.
Journal of experimental botany, 77(6):1874-1887.
Wild cucumber (Echinocystis lobata) is an invasive annual vine rapidly spreading across Central European riparian zones. Its success is linked to seed dispersal, with hydrochory expected to play a major role, but the specific mechanisms are not fully understood. This study examines whether E. lobata uses a dual dispersal strategy by seed morphological differences and hydrodynamic behavior, supporting both short-distance and long-distance dispersal. Seeds were collected in autumn and early spring, and analysed for morphology, buoyancy, and hydrodynamic properties. Over 150 seeds underwent biometric measurements: digital image correlation for swelling deformation, micro-computed tomography for internal structure, and hydrodynamic properties. Approximately 23% of seeds were buoyant, with buoyant ones present in both autumn and spring seed groups. Buoyant seeds had larger surface areas and internal air cavities, contributing to lower drag and enhanced passive transport in water. Using digital image correlation and micro-computed tomography imaging, we visualized seed coat swelling patterns and quantified internal structures. Hydrodynamic experiments revealed that buoyant seeds experienced lower drag and slower acceleration. Under oscillatory flow, buoyant seeds exhibited passive propulsion at 1 Hz, indicating a resonance effect facilitating dispersal during fluctuating water flow. These findings support a dual dispersal strategy: temporal seed release and buoyancy enable both local recruitment and long-distance dispersal, likely contributing to invasive success in riparian habitats.
Additional Links: PMID-41340246
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41340246,
year = {2026},
author = {Dołkin-Lewko, A and Baj, P and Giedrowicz, A and Jaroszewicz, J and Zajączkowska, U},
title = {Wild cucumber invasiveness: impact of seasonal changes on biometric seed traits and dispersal strategy.},
journal = {Journal of experimental botany},
volume = {77},
number = {6},
pages = {1874-1887},
doi = {10.1093/jxb/eraf526},
pmid = {41340246},
issn = {1460-2431},
support = {2022/45/N/NZ9/02690//National Science Centre, Poland/ ; },
mesh = {Seasons ; *Seeds/physiology/anatomy & histology ; *Seed Dispersal ; *Introduced Species ; X-Ray Microtomography ; Hydrodynamics ; *Cuscuta/physiology ; },
abstract = {Wild cucumber (Echinocystis lobata) is an invasive annual vine rapidly spreading across Central European riparian zones. Its success is linked to seed dispersal, with hydrochory expected to play a major role, but the specific mechanisms are not fully understood. This study examines whether E. lobata uses a dual dispersal strategy by seed morphological differences and hydrodynamic behavior, supporting both short-distance and long-distance dispersal. Seeds were collected in autumn and early spring, and analysed for morphology, buoyancy, and hydrodynamic properties. Over 150 seeds underwent biometric measurements: digital image correlation for swelling deformation, micro-computed tomography for internal structure, and hydrodynamic properties. Approximately 23% of seeds were buoyant, with buoyant ones present in both autumn and spring seed groups. Buoyant seeds had larger surface areas and internal air cavities, contributing to lower drag and enhanced passive transport in water. Using digital image correlation and micro-computed tomography imaging, we visualized seed coat swelling patterns and quantified internal structures. Hydrodynamic experiments revealed that buoyant seeds experienced lower drag and slower acceleration. Under oscillatory flow, buoyant seeds exhibited passive propulsion at 1 Hz, indicating a resonance effect facilitating dispersal during fluctuating water flow. These findings support a dual dispersal strategy: temporal seed release and buoyancy enable both local recruitment and long-distance dispersal, likely contributing to invasive success in riparian habitats.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Seasons
*Seeds/physiology/anatomy & histology
*Seed Dispersal
*Introduced Species
X-Ray Microtomography
Hydrodynamics
*Cuscuta/physiology
RevDate: 2026-03-17
CmpDate: 2026-03-17
Parallel concepts and future opportunities across the biological control and invasion sciences.
Journal of environmental management, 402:128931.
The biological control and invasion sciences are long-standing research fields that have accrued enormous fundamental and applied interest. However, their theoretical and practical integration remains in its infancy. Utilizing an expert elicitation process with participants spanning these sciences, we identify conceptual parallels and future opportunities to strengthen links and address future challenges in both fields. We found that the biological control and invasion sciences face pervasive context-dependencies that must be understood to improve outcome predictions, including climatic changes, spatiotemporal scales, and 'ecological surprises'. Both sciences would further benefit from terminological streamlining to improve communication, sharing of emerging technologies, and mitigation of the taxonomic decline. The two fields are strongly affected by social perceptions and awareness by decision makers, requiring more effective engagement and translation efforts. Our exercise promotes cross-cutting interdisciplinary advances to improve understanding of fundamental ecological and evolutionary processes, socio-ecological challenges, and management efficacy across the biological control and invasion sciences.
Additional Links: PMID-41762510
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41762510,
year = {2026},
author = {Cuthbert, RN and Baso, N and Chikodza, T and Coombes, C and Doherty, J and Githae, M and Griffith, TC and Hernandez, MR and Jaschke, KM and Jukes, MD and Kinsler, D and MacIsaac, HJ and Mantshi, HT and Muskett, P and Mutamiswa, R and Ricciardi, A and Sutton, GF and Tanka, DV and van Dyk, J and van Steenderen, C and Dick, JTA and Coetzee, J},
title = {Parallel concepts and future opportunities across the biological control and invasion sciences.},
journal = {Journal of environmental management},
volume = {402},
number = {},
pages = {128931},
doi = {10.1016/j.jenvman.2026.128931},
pmid = {41762510},
issn = {1095-8630},
mesh = {*Introduced Species ; Ecology ; Climate Change ; Ecosystem ; *Conservation of Natural Resources ; Humans ; },
abstract = {The biological control and invasion sciences are long-standing research fields that have accrued enormous fundamental and applied interest. However, their theoretical and practical integration remains in its infancy. Utilizing an expert elicitation process with participants spanning these sciences, we identify conceptual parallels and future opportunities to strengthen links and address future challenges in both fields. We found that the biological control and invasion sciences face pervasive context-dependencies that must be understood to improve outcome predictions, including climatic changes, spatiotemporal scales, and 'ecological surprises'. Both sciences would further benefit from terminological streamlining to improve communication, sharing of emerging technologies, and mitigation of the taxonomic decline. The two fields are strongly affected by social perceptions and awareness by decision makers, requiring more effective engagement and translation efforts. Our exercise promotes cross-cutting interdisciplinary advances to improve understanding of fundamental ecological and evolutionary processes, socio-ecological challenges, and management efficacy across the biological control and invasion sciences.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Introduced Species
Ecology
Climate Change
Ecosystem
*Conservation of Natural Resources
Humans
RevDate: 2026-03-16
CmpDate: 2026-03-16
Mammal defaunation leads to biotic homogenization of plant communities in tropical rainforests.
Ecology, 107(3):e70341.
Biotic homogenization is the process in which species communities become increasingly similar across different regions over time. This phenomenon has substantial ecological, evolutionary, and economic implications, primarily driven by human activities such as habitat destruction, invasive species introduction, and climate change. An underexplored driver of biotic homogenization is defaunation, particularly the loss or population decline of large herbivorous mammals and its consequences on plant communities. In this study, we examined how defaunation of medium- to large-sized mammals, such as tapirs and peccaries, affects taxonomic biotic homogenization in seedling and sapling communities in tropical rainforests of South America. Using data from a 13-year mammal-exclosure experiment across four forest sites in the Brazilian Atlantic Forest, we investigated the effects of defaunation on both alpha and beta diversity to understand how it might contribute to biotic homogenization. Our results indicate that defaunation significantly increased alpha diversity in exclusion plots over time, contrary to expectations, with more pronounced effects at forest sites hosting more complete mammal assemblies, that is, with greater mammal abundance and diversity. In contrast, beta diversity decreased as exclusion treatments led to more spatially homogeneous plant communities, particularly at the site where exclusion treatment prevents access to the plant community by the most complete mammal assembly. This homogenization was driven by reduced species turnover and the dominance of a few plant species that thrive in the absence of mammal herbivores, including a palm Euterpe edulis, a bamboo Merostachys neesii, and a fern Polybotrya cylindrica. These findings suggest that the removal of medium- to large-sized mammal herbivores can lead to both increased local species richness and decreased spatial heterogeneity, reshaping plant community structure across tropical forest landscapes. Our study highlights the critical role of large-bodied herbivores in maintaining biodiversity at multiple scales and underscores the ecological consequences of their functional loss. This work provides essential insights for conservation efforts aimed at mitigating the impacts of defaunation and preserving the resilience of tropical forest ecosystems, positioning defaunation as a significant anthropogenic driver of biotic homogenization.
Additional Links: PMID-41839725
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41839725,
year = {2026},
author = {Ribas, LGDS and Villar, N and Zipparro, V and Nazareth, S and Souza, Y and Brocardo, CR and Schmaedecke, G and Hortenci, L and Alves, RSC and Galetti, M},
title = {Mammal defaunation leads to biotic homogenization of plant communities in tropical rainforests.},
journal = {Ecology},
volume = {107},
number = {3},
pages = {e70341},
doi = {10.1002/ecy.70341},
pmid = {41839725},
issn = {1939-9170},
support = {//São Paulo State University (UNESP)/ ; 2022/09561-4//São Paulo Research Foundation/ ; 2014/01986-0//São Paulo Research Foundation/ ; 43.104/2007//Fundação Florestal do Estado de São Paulo/ ; 15333/2022//Fundação Florestal do Estado de São Paulo/ ; },
mesh = {Animals ; *Rainforest ; *Mammals/physiology ; Tropical Climate ; *Plants/classification ; Brazil ; *Biodiversity ; },
abstract = {Biotic homogenization is the process in which species communities become increasingly similar across different regions over time. This phenomenon has substantial ecological, evolutionary, and economic implications, primarily driven by human activities such as habitat destruction, invasive species introduction, and climate change. An underexplored driver of biotic homogenization is defaunation, particularly the loss or population decline of large herbivorous mammals and its consequences on plant communities. In this study, we examined how defaunation of medium- to large-sized mammals, such as tapirs and peccaries, affects taxonomic biotic homogenization in seedling and sapling communities in tropical rainforests of South America. Using data from a 13-year mammal-exclosure experiment across four forest sites in the Brazilian Atlantic Forest, we investigated the effects of defaunation on both alpha and beta diversity to understand how it might contribute to biotic homogenization. Our results indicate that defaunation significantly increased alpha diversity in exclusion plots over time, contrary to expectations, with more pronounced effects at forest sites hosting more complete mammal assemblies, that is, with greater mammal abundance and diversity. In contrast, beta diversity decreased as exclusion treatments led to more spatially homogeneous plant communities, particularly at the site where exclusion treatment prevents access to the plant community by the most complete mammal assembly. This homogenization was driven by reduced species turnover and the dominance of a few plant species that thrive in the absence of mammal herbivores, including a palm Euterpe edulis, a bamboo Merostachys neesii, and a fern Polybotrya cylindrica. These findings suggest that the removal of medium- to large-sized mammal herbivores can lead to both increased local species richness and decreased spatial heterogeneity, reshaping plant community structure across tropical forest landscapes. Our study highlights the critical role of large-bodied herbivores in maintaining biodiversity at multiple scales and underscores the ecological consequences of their functional loss. This work provides essential insights for conservation efforts aimed at mitigating the impacts of defaunation and preserving the resilience of tropical forest ecosystems, positioning defaunation as a significant anthropogenic driver of biotic homogenization.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Rainforest
*Mammals/physiology
Tropical Climate
*Plants/classification
Brazil
*Biodiversity
RevDate: 2026-03-15
Climate change-driven expansion of goosegrass highlights risks to global food production.
Pest management science [Epub ahead of print].
BACKGROUND: Climate change and the spread of herbicide-resistant weeds pose increasing risks to global food security. Eleusine indica (goosegrass) is a globally invasive species characterized by broad geographic distribution, high ecological plasticity, and multiple resistance mechanisms. This study evaluated the current and future climatic suitability of E. indica at a global scale under climate change scenarios.
RESULTS: Ensemble ecological niche models calibrated with georeferenced occurrence records and climatic predictors showed excellent performance (area under the receiver operating characteristic curve (AUC) = 0.999; true skill statistic (TSS)/kappa = 0.980), with low omission rates and high spatial agreement among algorithms (Bioclim, Random Forest, Support Vector Machines, and Maxent). Current projections indicate widespread suitability across tropical and subtropical regions, particularly in South America, Africa, and Southeast Asia. Future projections under SSP245 and SSP585 for 2050 and 2090 suggest a gradual expansion toward higher latitudes, with increased suitability in temperate regions such as the US Corn Belt, the Mediterranean Basin, and East Asia, especially under SSP585 by 2090. Overlap analyses identified substantial vulnerability in major soybean-producing regions, including Brazil, Argentina, the United States, and Southeast Asia.
CONCLUSION: Climate change is expected to facilitate the poleward expansion of E. indica, increasing invasion risk in key agricultural regions while maintaining broad climatic stability across its current range. These findings emphasize the need for early detection, continuous monitoring, and integrated weed management strategies to mitigate long-term agronomic and food security risks posed by this globally invasive species. © 2026 The Author(s). Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry.
Additional Links: PMID-41833552
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41833552,
year = {2026},
author = {Ludwig, TD and Borgato, EA and de Avila, LA and Roncaglia, LM and Zucchi, MI},
title = {Climate change-driven expansion of goosegrass highlights risks to global food production.},
journal = {Pest management science},
volume = {},
number = {},
pages = {},
doi = {10.1002/ps.70731},
pmid = {41833552},
issn = {1526-4998},
support = {//Coordenação de Aperfeiçoamento de Pessoal de Nível Superior/ ; },
abstract = {BACKGROUND: Climate change and the spread of herbicide-resistant weeds pose increasing risks to global food security. Eleusine indica (goosegrass) is a globally invasive species characterized by broad geographic distribution, high ecological plasticity, and multiple resistance mechanisms. This study evaluated the current and future climatic suitability of E. indica at a global scale under climate change scenarios.
RESULTS: Ensemble ecological niche models calibrated with georeferenced occurrence records and climatic predictors showed excellent performance (area under the receiver operating characteristic curve (AUC) = 0.999; true skill statistic (TSS)/kappa = 0.980), with low omission rates and high spatial agreement among algorithms (Bioclim, Random Forest, Support Vector Machines, and Maxent). Current projections indicate widespread suitability across tropical and subtropical regions, particularly in South America, Africa, and Southeast Asia. Future projections under SSP245 and SSP585 for 2050 and 2090 suggest a gradual expansion toward higher latitudes, with increased suitability in temperate regions such as the US Corn Belt, the Mediterranean Basin, and East Asia, especially under SSP585 by 2090. Overlap analyses identified substantial vulnerability in major soybean-producing regions, including Brazil, Argentina, the United States, and Southeast Asia.
CONCLUSION: Climate change is expected to facilitate the poleward expansion of E. indica, increasing invasion risk in key agricultural regions while maintaining broad climatic stability across its current range. These findings emphasize the need for early detection, continuous monitoring, and integrated weed management strategies to mitigate long-term agronomic and food security risks posed by this globally invasive species. © 2026 The Author(s). Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry.},
}
RevDate: 2026-03-16
An ovary-enriched piRNA controls ovarian development via Gadd45a-JNK-mediated nurse-cell apoptosis in the arbovirus vector Aedes albopictus.
Insect science [Epub ahead of print].
The Asian tiger mosquito (Aedes albopictus) is a rapidly expanding invasive species and a global vector of arboviruses. Its transmission depends on the female's blood meal-driven reproductive cycle. Although mosquito PIWI-interacting RNAs (piRNAs) research has predominantly focused on antiviral immunity, their roles in reproduction remain poorly understood. Here we profiled sex-biased piRNA expression in Ae. albopictus and identified a female-enriched piRNA, AalpiRNA-18529. This piRNA accumulates in pre-vitellogenic ovaries and is rapidly downregulated after a blood meal. Gain-of-function experiments showed that AalpiRNA-18529 mimics impair follicle development, reduces fecundity and egg hatching, and disrupts nurse-cell apoptosis required for oocyte maturation. Mechanistically, AalpiRNA-18529 represses Gadd45a, a conserved stress-response regulator. Gadd45a knockdown phenocopies AalpiRNA-18529 gain-of-function, leading to reduced phosphorylation of c-Jun N-terminal kinase (JNK) and thus indicating defective activation of the Gadd45a-JNK apoptotic axis. Collectively, our findings reveal a piRNA-mediated pathway that controls ovarian development in Ae. albopictus during vitellogenesis and highlight the AalpiRNA-18529-Gadd45a-JNK cascade as a potential molecular target for genetic strategies to disrupt mosquito reproduction.
Additional Links: PMID-41834686
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41834686,
year = {2026},
author = {Yang, L and Gao, Y and Chen, Y and Ren, S and Lu, H and Guo, Y and Liu, P and Batool, K and Chen, XG and Tang, J and Gu, J},
title = {An ovary-enriched piRNA controls ovarian development via Gadd45a-JNK-mediated nurse-cell apoptosis in the arbovirus vector Aedes albopictus.},
journal = {Insect science},
volume = {},
number = {},
pages = {},
doi = {10.1111/1744-7917.70262},
pmid = {41834686},
issn = {1744-7917},
support = {//National Natural Science Foundation of China/ ; //Natural Science Foundation of Guangdong Province/ ; //National Health Commission Key Laboratory of Parasitic Disease Control and Prevention/ ; },
abstract = {The Asian tiger mosquito (Aedes albopictus) is a rapidly expanding invasive species and a global vector of arboviruses. Its transmission depends on the female's blood meal-driven reproductive cycle. Although mosquito PIWI-interacting RNAs (piRNAs) research has predominantly focused on antiviral immunity, their roles in reproduction remain poorly understood. Here we profiled sex-biased piRNA expression in Ae. albopictus and identified a female-enriched piRNA, AalpiRNA-18529. This piRNA accumulates in pre-vitellogenic ovaries and is rapidly downregulated after a blood meal. Gain-of-function experiments showed that AalpiRNA-18529 mimics impair follicle development, reduces fecundity and egg hatching, and disrupts nurse-cell apoptosis required for oocyte maturation. Mechanistically, AalpiRNA-18529 represses Gadd45a, a conserved stress-response regulator. Gadd45a knockdown phenocopies AalpiRNA-18529 gain-of-function, leading to reduced phosphorylation of c-Jun N-terminal kinase (JNK) and thus indicating defective activation of the Gadd45a-JNK apoptotic axis. Collectively, our findings reveal a piRNA-mediated pathway that controls ovarian development in Ae. albopictus during vitellogenesis and highlight the AalpiRNA-18529-Gadd45a-JNK cascade as a potential molecular target for genetic strategies to disrupt mosquito reproduction.},
}
RevDate: 2026-03-16
CmpDate: 2026-03-16
Species-specific responses of invasive plants to parasitism are modified by climate warming.
AoB PLANTS, 18(2):plag015.
Parasitic plants can inflict significant damage to invasive plants and are considered biocontrol agents. Climate warming can affect the fitness of invasive plants and the efficacy of their biocontrol agents. However, the impact of climate warming on the responses of invasive plants to parasitism remains inadequately explored. To investigate this critical issue, we conducted a controlled warming experiment to assess the impact of a constant, continuous +2 °C temperature increase, consistent with projected global warming scenarios reported by the Intergovernmental Panel on Climate Change, on the responses of two common invasive plants in China, Solidago canadensis and Bidens pilosa to the parasitic plant Cuscuta gronovii. Our findings indicate that parasitism significantly reduces the growth of both invasive species irrespective of temperature increases. A significant interaction was observed between Cuscuta parasitism and the different host species, particularly affecting stem diameter, plant height, and root-to-shoot ratio of the host plants. Interestingly, while increased temperature independently did not significantly impact total biomass, aboveground biomass, or leaf number of the host plants, it exhibited marginal interactions with parasitism and the different hosts regarding belowground biomass of the hosts. Moreover, C. gronovii biomass was significantly influenced by host type; however, increased temperatures did not significantly affect the biomass of C. gronovii or its deleterious effects on host plants. Overall, these findings highlight the complex interplay among parasitism, host species, and environmental factors, which are crucial for comprehensively understanding invasive species dynamics and their ecological implications.
Additional Links: PMID-41834842
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41834842,
year = {2026},
author = {Cai, C and Yuan, Y and Wu, D and Li, J},
title = {Species-specific responses of invasive plants to parasitism are modified by climate warming.},
journal = {AoB PLANTS},
volume = {18},
number = {2},
pages = {plag015},
pmid = {41834842},
issn = {2041-2851},
abstract = {Parasitic plants can inflict significant damage to invasive plants and are considered biocontrol agents. Climate warming can affect the fitness of invasive plants and the efficacy of their biocontrol agents. However, the impact of climate warming on the responses of invasive plants to parasitism remains inadequately explored. To investigate this critical issue, we conducted a controlled warming experiment to assess the impact of a constant, continuous +2 °C temperature increase, consistent with projected global warming scenarios reported by the Intergovernmental Panel on Climate Change, on the responses of two common invasive plants in China, Solidago canadensis and Bidens pilosa to the parasitic plant Cuscuta gronovii. Our findings indicate that parasitism significantly reduces the growth of both invasive species irrespective of temperature increases. A significant interaction was observed between Cuscuta parasitism and the different host species, particularly affecting stem diameter, plant height, and root-to-shoot ratio of the host plants. Interestingly, while increased temperature independently did not significantly impact total biomass, aboveground biomass, or leaf number of the host plants, it exhibited marginal interactions with parasitism and the different hosts regarding belowground biomass of the hosts. Moreover, C. gronovii biomass was significantly influenced by host type; however, increased temperatures did not significantly affect the biomass of C. gronovii or its deleterious effects on host plants. Overall, these findings highlight the complex interplay among parasitism, host species, and environmental factors, which are crucial for comprehensively understanding invasive species dynamics and their ecological implications.},
}
RevDate: 2026-03-16
CmpDate: 2026-03-16
A Weibull distribution-based method for estimating seed longevity in Solanum rostratum.
Frontiers in plant science, 17:1700839.
INTRODUCTION: Seed longevity is a key determinant of population persistence, spread, and outbreak potential in annual invasive plant species. Understanding longevity of invasive seed bank is crucial for determining colonization timing and assessing invasion potential, thereby supporting sustainable weed management strategies. While soil seed bank fluctuations have become a focus in invasion biology area, efficient and accurate methods for evaluating seed bank longevity in annual invasive plants remain scarce so far. In this study, we focus on a representative annual globally malignant invasive plant Solanum rostratum, investigating seed longevity by accelerated aging test (60°C and 85% relative humidity) across multiple regions and collection years.
METHODS: We used a three-parameter Weibull distribution model to characterize seed aging and applied it to assess S. rostratum seed bank longevity in both grassland and abandoned farmland habitats.
RESULTS: The results showed that S. rostratum seeds lost viability rapidly within 3 d under accelerated aging condition. Seeds from different regions in the same year exhibited similar aging patterns, while interannual variation led to significantly divergent aging curves. Based on polynomial regression of viability data and germination tests, the upper limit of seed longevity under natural field conditions was estimated to be approximately 8-9.79 years.
DISCUSSION: This study demonstrates that combining accelerated aging assays with the three-parameter Weibull distribution provides an effective approach for assessing seed longevity and soil seed bank persistence. The method offers a practical, efficient, and reproducible framework for estimating seed bank persistence in annual invasive plants. Our findings highlight the critical role of persistent seed banks in facilitating the invasion success of S. rostratum, thereby offering a robust analytical basis for evaluating invasion risks. Moreover, the modeling framework developed here can be extended to other annual plant species for seed viability assessment, providing valuable theoretical support for the development of ecologically sustainable weed management strategies.
Additional Links: PMID-41835274
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41835274,
year = {2026},
author = {Yuan, Z and Fu, W and Song, Z and Wang, Z and Sun, C and Zhang, Y and Zhang, G},
title = {A Weibull distribution-based method for estimating seed longevity in Solanum rostratum.},
journal = {Frontiers in plant science},
volume = {17},
number = {},
pages = {1700839},
pmid = {41835274},
issn = {1664-462X},
abstract = {INTRODUCTION: Seed longevity is a key determinant of population persistence, spread, and outbreak potential in annual invasive plant species. Understanding longevity of invasive seed bank is crucial for determining colonization timing and assessing invasion potential, thereby supporting sustainable weed management strategies. While soil seed bank fluctuations have become a focus in invasion biology area, efficient and accurate methods for evaluating seed bank longevity in annual invasive plants remain scarce so far. In this study, we focus on a representative annual globally malignant invasive plant Solanum rostratum, investigating seed longevity by accelerated aging test (60°C and 85% relative humidity) across multiple regions and collection years.
METHODS: We used a three-parameter Weibull distribution model to characterize seed aging and applied it to assess S. rostratum seed bank longevity in both grassland and abandoned farmland habitats.
RESULTS: The results showed that S. rostratum seeds lost viability rapidly within 3 d under accelerated aging condition. Seeds from different regions in the same year exhibited similar aging patterns, while interannual variation led to significantly divergent aging curves. Based on polynomial regression of viability data and germination tests, the upper limit of seed longevity under natural field conditions was estimated to be approximately 8-9.79 years.
DISCUSSION: This study demonstrates that combining accelerated aging assays with the three-parameter Weibull distribution provides an effective approach for assessing seed longevity and soil seed bank persistence. The method offers a practical, efficient, and reproducible framework for estimating seed bank persistence in annual invasive plants. Our findings highlight the critical role of persistent seed banks in facilitating the invasion success of S. rostratum, thereby offering a robust analytical basis for evaluating invasion risks. Moreover, the modeling framework developed here can be extended to other annual plant species for seed viability assessment, providing valuable theoretical support for the development of ecologically sustainable weed management strategies.},
}
RevDate: 2026-03-16
CmpDate: 2026-03-16
Impact of niche shift on the spread of Aedes aegypti (Diptera: Culicidae) to and within Japan.
Journal of medical entomology, 63(2):.
Arbovirus transmission is a global public health concern. The mosquito Aedes aegypti L. (Diptera: Culicidae) is a primary vector of some of these viruses, and its distribution has been a long-term concern because of its vector competence and invasiveness. The invasion and establishment of Ae. aegypti in temperate regions has been extensively discussed, with recent studies reporting phenotypic and evolutionary changes in populations attempting to breed in temperate regions. We used occurrence data from regions with environmental conditions similar to those in Japan to model the potential distribution of Ae. aegypti in Japan, as site-related environmental conditions represent selection pressure for phenotypic and/or evolutionary changes. A random forest model was used for prediction utilizing 3,062 selected occurrence data with a similarity mask. To screen out the drivers affecting adaptability and niche shifts in temperate regions, the above model and a global model using both native and invasive occurrence data were compared. The model predicts that urban areas are the main breeding sites for Ae. aegypti in Japan. Due to competition with the dominant local species, Aedes albopictus Skuse, Ae. aegypti cannot occupy the entire range of urban settings. A niche shift was observed compared to the global model. Niche-shifted populations underwent more rigorous selection for temperature and precipitation, shifting toward human-dwelling environments. These divergences, which warrant further exploration, may be attributed to phenotypic changes or adaptive evolution as mosquito populations persist in temperate regions. The generated prediction maps provide useful insights to understand the expansion of this species.
Additional Links: PMID-41837865
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41837865,
year = {2026},
author = {Yang, C and Komagata, O and Kasai, S and Higa, Y},
title = {Impact of niche shift on the spread of Aedes aegypti (Diptera: Culicidae) to and within Japan.},
journal = {Journal of medical entomology},
volume = {63},
number = {2},
pages = {},
doi = {10.1093/jme/tjag032},
pmid = {41837865},
issn = {1938-2928},
support = {JP23wm0225030//Japan Agency for Medical Research and Development/ ; JP24wm0225030//Japan Agency for Medical Research and Development/ ; JP23fk0108613//Japan Agency for Medical Research and Development/ ; JP24fk0108693//Japan Agency for Medical Research and Development/ ; },
mesh = {Animals ; *Aedes/physiology ; Japan ; *Animal Distribution ; *Mosquito Vectors/physiology ; *Ecosystem ; },
abstract = {Arbovirus transmission is a global public health concern. The mosquito Aedes aegypti L. (Diptera: Culicidae) is a primary vector of some of these viruses, and its distribution has been a long-term concern because of its vector competence and invasiveness. The invasion and establishment of Ae. aegypti in temperate regions has been extensively discussed, with recent studies reporting phenotypic and evolutionary changes in populations attempting to breed in temperate regions. We used occurrence data from regions with environmental conditions similar to those in Japan to model the potential distribution of Ae. aegypti in Japan, as site-related environmental conditions represent selection pressure for phenotypic and/or evolutionary changes. A random forest model was used for prediction utilizing 3,062 selected occurrence data with a similarity mask. To screen out the drivers affecting adaptability and niche shifts in temperate regions, the above model and a global model using both native and invasive occurrence data were compared. The model predicts that urban areas are the main breeding sites for Ae. aegypti in Japan. Due to competition with the dominant local species, Aedes albopictus Skuse, Ae. aegypti cannot occupy the entire range of urban settings. A niche shift was observed compared to the global model. Niche-shifted populations underwent more rigorous selection for temperature and precipitation, shifting toward human-dwelling environments. These divergences, which warrant further exploration, may be attributed to phenotypic changes or adaptive evolution as mosquito populations persist in temperate regions. The generated prediction maps provide useful insights to understand the expansion of this species.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Aedes/physiology
Japan
*Animal Distribution
*Mosquito Vectors/physiology
*Ecosystem
RevDate: 2026-03-16
CmpDate: 2026-03-16
Suitable ecological niches of invasive malaria vector under present and projected climatic conditions in South of Iran.
PLoS neglected tropical diseases, 20(3):e0014054 pii:PNTD-D-25-01044.
BACKGROUND: The invasive mosquito species Anopheles stephensi plays a critical role in malaria transmission, particularly in urban environments. Its ability to thrive in such settings has raised public health concerns, especially as it expands its geographical range. The resurgence of malaria in Iran underscores the challenges posed by this vector, which is further complicated by factors such as climate change and the movement of populations. Understanding the ecological niches of An. stephensi is essential for developing targeted malaria control strategies. This study aims to assess the current and projected distribution of An. stephensi in Hormozgan Province, Iran, under varying climatic conditions.
METHOD: The study was conducted in Hormozgan Province, Iran, characterized by a hot, arid climate. A database of 96 occurrence points for An. stephensi was compiled through literature searches, which were refined to 72 points to ensure data quality. Environmental and bioclimatic data were sourced from the WorldClim v2.1 database, with a focus on various Shared Socioeconomic Pathways (SSPs). The MaxEnt modeling technique was employed to assess the impact of climate change on the species' distribution, with model performance evaluated using the two metrics, Area Under the Curve (AUC) and True Skill Statistic (TSS). The analysis aimed to map shifts in suitable habitats under different climate scenarios.
RESULTS: The MaxEnt model predicts a significant decline in environmental suitability for An. stephensi under future climate scenarios, particularly in western and central Hormozgan Province. Habitat loss is prevalent, with stable areas primarily located in Bashagard County. Factors such as altitude and precipitation patterns significantly influence species distribution, with altitude showing the highest impact. The model's performance, indicated by an average AUC of 0.765 and a TSS of 0.519, demonstrates moderate predictive accuracy for identifying suitable habitats.
DISCUSSION: Despite advancements in malaria control, An. stephensi remains a significant threat in Iran, particularly due to its invasive nature and adaptability to climate change. The study indicates a projected decline in suitable habitats, especially in coastal areas, highlighting the need for adaptive vector control strategies. Bashagard County may serve as a stable refuge, warranting further investigation. The findings emphasize the importance of continuous monitoring and integrating climate projections into public health interventions to effectively combat malaria transmission. Overall, ongoing research is crucial to refining understanding and enhancing malaria control efforts in response to shifting environmental conditions.
Additional Links: PMID-41838734
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41838734,
year = {2026},
author = {Bozorg-Omid, F and Abbasi, M and Yaghoobi-Ershadi, MR and Hanafi-Bojd, AA},
title = {Suitable ecological niches of invasive malaria vector under present and projected climatic conditions in South of Iran.},
journal = {PLoS neglected tropical diseases},
volume = {20},
number = {3},
pages = {e0014054},
doi = {10.1371/journal.pntd.0014054},
pmid = {41838734},
issn = {1935-2735},
mesh = {Iran/epidemiology ; *Anopheles/physiology/growth & development ; *Mosquito Vectors/physiology ; *Malaria/transmission/epidemiology ; Animals ; Climate Change ; *Ecosystem ; Climate ; *Introduced Species ; Humans ; Animal Distribution ; },
abstract = {BACKGROUND: The invasive mosquito species Anopheles stephensi plays a critical role in malaria transmission, particularly in urban environments. Its ability to thrive in such settings has raised public health concerns, especially as it expands its geographical range. The resurgence of malaria in Iran underscores the challenges posed by this vector, which is further complicated by factors such as climate change and the movement of populations. Understanding the ecological niches of An. stephensi is essential for developing targeted malaria control strategies. This study aims to assess the current and projected distribution of An. stephensi in Hormozgan Province, Iran, under varying climatic conditions.
METHOD: The study was conducted in Hormozgan Province, Iran, characterized by a hot, arid climate. A database of 96 occurrence points for An. stephensi was compiled through literature searches, which were refined to 72 points to ensure data quality. Environmental and bioclimatic data were sourced from the WorldClim v2.1 database, with a focus on various Shared Socioeconomic Pathways (SSPs). The MaxEnt modeling technique was employed to assess the impact of climate change on the species' distribution, with model performance evaluated using the two metrics, Area Under the Curve (AUC) and True Skill Statistic (TSS). The analysis aimed to map shifts in suitable habitats under different climate scenarios.
RESULTS: The MaxEnt model predicts a significant decline in environmental suitability for An. stephensi under future climate scenarios, particularly in western and central Hormozgan Province. Habitat loss is prevalent, with stable areas primarily located in Bashagard County. Factors such as altitude and precipitation patterns significantly influence species distribution, with altitude showing the highest impact. The model's performance, indicated by an average AUC of 0.765 and a TSS of 0.519, demonstrates moderate predictive accuracy for identifying suitable habitats.
DISCUSSION: Despite advancements in malaria control, An. stephensi remains a significant threat in Iran, particularly due to its invasive nature and adaptability to climate change. The study indicates a projected decline in suitable habitats, especially in coastal areas, highlighting the need for adaptive vector control strategies. Bashagard County may serve as a stable refuge, warranting further investigation. The findings emphasize the importance of continuous monitoring and integrating climate projections into public health interventions to effectively combat malaria transmission. Overall, ongoing research is crucial to refining understanding and enhancing malaria control efforts in response to shifting environmental conditions.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Iran/epidemiology
*Anopheles/physiology/growth & development
*Mosquito Vectors/physiology
*Malaria/transmission/epidemiology
Animals
Climate Change
*Ecosystem
Climate
*Introduced Species
Humans
Animal Distribution
RevDate: 2026-03-14
CmpDate: 2026-03-14
Analysis of the Potential Distribution of Solanum rostratum in China Based on the Biomod2 Ensemble Model.
Plants (Basel, Switzerland), 15(5):.
Solanum rostratum is a globally regulated invasive species, known for its detrimental impacts on local biodiversity, human and livestock health, and agricultural productivity. This study employed the Biomod2 ensemble modeling framework to analyze the geographic distribution of S. rostratum in China, identify key environmental factors limiting its spread, and provide a scientific basis for its management and control. By integrating species distribution data with multiple environmental variables, we predicted the potential geographic distribution of this species. Pearson correlation analysis and variance inflation factor (VIF) testing were applied to identify significant environmental variables constraining its spread, including precipitation seasonality (bio15), mean temperature of the wettest quarter (bio8), precipitation of the warmest quarter (bio18), isothermality (bio3), precipitation of the driest month (bio14), and human footprint. Three Biomod2-based ensemble models (EMmean, EMca and EMwmean) were based on the receiver operating characteristic curve (ROC), true skill statistic (TSS), and Kappa coefficient. Of these, EMca demonstrated the highest predictive accuracy. The model identified highly suitable habitats for S. rostratum primarily in semi-arid and semi-humid regions with high human activity, including the Northeast Plain, bounded by the Greater Khingan, Lesser Khingan, and Changbai Mountains; the northern North China Plain extending to the Shandong Hills and Yellow River basin; and the Junggar Basin extending to the Altai Mountains. These regions should be prioritized for future monitoring and control efforts. This study provides both empirical data and theoretical insights to accurately delineate potential invasion zones of S. rostratum, enhancing surveillance and guiding effective prevention and control strategies.
Additional Links: PMID-41829847
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41829847,
year = {2026},
author = {Zhang, Y and Ma, W and Zhou, Q and Cao, W and Qu, B and Guo, J and Zhou, L and Deng, J and Zhang, Y and Li, Y and Dai, L},
title = {Analysis of the Potential Distribution of Solanum rostratum in China Based on the Biomod2 Ensemble Model.},
journal = {Plants (Basel, Switzerland)},
volume = {15},
number = {5},
pages = {},
pmid = {41829847},
issn = {2223-7747},
support = {2021YFD1400303//NNational Key Research and Development Program of China/ ; },
abstract = {Solanum rostratum is a globally regulated invasive species, known for its detrimental impacts on local biodiversity, human and livestock health, and agricultural productivity. This study employed the Biomod2 ensemble modeling framework to analyze the geographic distribution of S. rostratum in China, identify key environmental factors limiting its spread, and provide a scientific basis for its management and control. By integrating species distribution data with multiple environmental variables, we predicted the potential geographic distribution of this species. Pearson correlation analysis and variance inflation factor (VIF) testing were applied to identify significant environmental variables constraining its spread, including precipitation seasonality (bio15), mean temperature of the wettest quarter (bio8), precipitation of the warmest quarter (bio18), isothermality (bio3), precipitation of the driest month (bio14), and human footprint. Three Biomod2-based ensemble models (EMmean, EMca and EMwmean) were based on the receiver operating characteristic curve (ROC), true skill statistic (TSS), and Kappa coefficient. Of these, EMca demonstrated the highest predictive accuracy. The model identified highly suitable habitats for S. rostratum primarily in semi-arid and semi-humid regions with high human activity, including the Northeast Plain, bounded by the Greater Khingan, Lesser Khingan, and Changbai Mountains; the northern North China Plain extending to the Shandong Hills and Yellow River basin; and the Junggar Basin extending to the Altai Mountains. These regions should be prioritized for future monitoring and control efforts. This study provides both empirical data and theoretical insights to accurately delineate potential invasion zones of S. rostratum, enhancing surveillance and guiding effective prevention and control strategies.},
}
RevDate: 2026-03-14
CmpDate: 2026-03-14
Assessment of tick populations associated with capybaras in natural reserves and human-modified environments with or without invasive plants in the state of São Paulo, Brazil.
Experimental & applied acarology, 96(3):.
In southeastern Brazil, capybaras (Hydrochoerus hydrochaeris) are main hosts of the ticks Amblyomma dubitatum and Amblyomma sculptum; the latter has great medical importance for being the main vector of Rickettsia rickettsii, the agent of Brazilian spotted fever (BSF). This study aimed to quantify ticks in areas invaded and not invaded by exotic plants (Hedychium coronarium, Cenchrus purpureus or Megathyrsus maximus) within capybaras' living areas in São Paulo state. Tick populations were quantified in 24 capybara habitats, eight in natural reserves and 16 human-modified landscapes; the latter were composed of eight BSF-endemic areas and eight BSF-nonendemic areas. In the 24 areas, ticks were sampled in plots of natural forests and plots with at least one of the three invasive plants. Both presence and density of A. sculptum were higher in human-modified landscapes, while the presence and density of A. dubitatum tended to be similar among human-modified landscapes and natural reserve areas. The two tick species were collected both in areas colonized by invasive plants (H. coronarium, M. maximus, and/or C. purpureus) and in areas of non-invaded vegetation. However, a higher density of A. dubitatum was observed in areas of H. coronarium and a lower density of A. sculptum in this type of vegetation. Within human-modified landscapes, there was a higher density of A. sculptum in BSF-endemic areas when compared to non-endemic areas, unlike A. dubitatum, which remained at an almost constant density and presence among BSF-endemic and non-endemic areas. Plant invasions may have some role in the ecology of capybara-associated ticks.
Additional Links: PMID-41830990
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41830990,
year = {2026},
author = {Pasini-Martins, M and Kuhne, RDT and de Oliveira, CM and Binder, LC and Silito, IS and Pinter, A and Nunes, FBP and Martins, TF and de Hildebrand E Grisi Filho, JH and Dawson, W and Stephens, PA and da Silva Matos, DM and Labruna, MB},
title = {Assessment of tick populations associated with capybaras in natural reserves and human-modified environments with or without invasive plants in the state of São Paulo, Brazil.},
journal = {Experimental & applied acarology},
volume = {96},
number = {3},
pages = {},
pmid = {41830990},
issn = {1572-9702},
mesh = {Animals ; Brazil ; *Introduced Species ; *Rodentia/parasitology ; *Amblyomma/physiology/growth & development ; Population Density ; Ecosystem ; Conservation of Natural Resources ; Nymph/physiology/growth & development ; },
abstract = {In southeastern Brazil, capybaras (Hydrochoerus hydrochaeris) are main hosts of the ticks Amblyomma dubitatum and Amblyomma sculptum; the latter has great medical importance for being the main vector of Rickettsia rickettsii, the agent of Brazilian spotted fever (BSF). This study aimed to quantify ticks in areas invaded and not invaded by exotic plants (Hedychium coronarium, Cenchrus purpureus or Megathyrsus maximus) within capybaras' living areas in São Paulo state. Tick populations were quantified in 24 capybara habitats, eight in natural reserves and 16 human-modified landscapes; the latter were composed of eight BSF-endemic areas and eight BSF-nonendemic areas. In the 24 areas, ticks were sampled in plots of natural forests and plots with at least one of the three invasive plants. Both presence and density of A. sculptum were higher in human-modified landscapes, while the presence and density of A. dubitatum tended to be similar among human-modified landscapes and natural reserve areas. The two tick species were collected both in areas colonized by invasive plants (H. coronarium, M. maximus, and/or C. purpureus) and in areas of non-invaded vegetation. However, a higher density of A. dubitatum was observed in areas of H. coronarium and a lower density of A. sculptum in this type of vegetation. Within human-modified landscapes, there was a higher density of A. sculptum in BSF-endemic areas when compared to non-endemic areas, unlike A. dubitatum, which remained at an almost constant density and presence among BSF-endemic and non-endemic areas. Plant invasions may have some role in the ecology of capybara-associated ticks.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
Brazil
*Introduced Species
*Rodentia/parasitology
*Amblyomma/physiology/growth & development
Population Density
Ecosystem
Conservation of Natural Resources
Nymph/physiology/growth & development
RevDate: 2026-03-14
The hidden passengers: On the role of exotic crayfish in the spread of symbiotic and pathogenic organisms in northern Iberian Peninsula.
Journal of invertebrate pathology pii:S0022-2011(26)00072-8 [Epub ahead of print].
The spread of invasive crayfish species poses a growing threat to freshwater ecosystems and public health, not only through direct ecological impacts but also by facilitating the transmission of symbionts and potential zoonotic pathogens. This study characterizes the symbiont diversity associated with the crayfish species that occur in northern Spain. In addition, the first comprehensive and comparative compilation of reported symbiont and parasite species of crayfish species reported in Iberia is provided. A combination of scanning electron and optical microscopy analysis and a review of the literature was employed to identify the symbionts and evaluate their spatial distribution on the host, their taxonomy, and their zoonotic potential. A total of five crayfish species were analyzed, with symbionts recorded across multiple body regions, particularly the chelipeds, gills, and pleopods. The most prevalent taxa belonged to the phyla Ciliophora, Annelida, and Platyhelminthes. Some symbionts, such as Xironogiton victoriensis and Uncinocythere occidentalis, were identified as obligate ectosymbionts that could have a negative impact on protected species such as Austropotamobius fulcisianus. Furthermore, several symbiont taxa (e.g., Fusarium sp., and Paragonimus spp.) are known to be zoonotic and are associated with conditions such as keratitis, onychomycosis, and paragonimiasis. The results highlight the dual ecological and epidemiological risk posed by crayfish invasions. As vectors of both invasive symbionts and zoonotic agents, these crustaceans may facilitate the emergence of new infectious diseases in freshwater environments. This underscores the need for integrated monitoring strategies that consider symbiont-host dynamics in invasive species management and public health surveillance and highlights the importance of implementing targeted management actions to mitigate ecological impacts and reduce associated health risks.
Additional Links: PMID-41831708
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41831708,
year = {2026},
author = {Sánchez, O and González, IC and Poyo, JG and Ureña, M and Arias, A},
title = {The hidden passengers: On the role of exotic crayfish in the spread of symbiotic and pathogenic organisms in northern Iberian Peninsula.},
journal = {Journal of invertebrate pathology},
volume = {},
number = {},
pages = {108598},
doi = {10.1016/j.jip.2026.108598},
pmid = {41831708},
issn = {1096-0805},
abstract = {The spread of invasive crayfish species poses a growing threat to freshwater ecosystems and public health, not only through direct ecological impacts but also by facilitating the transmission of symbionts and potential zoonotic pathogens. This study characterizes the symbiont diversity associated with the crayfish species that occur in northern Spain. In addition, the first comprehensive and comparative compilation of reported symbiont and parasite species of crayfish species reported in Iberia is provided. A combination of scanning electron and optical microscopy analysis and a review of the literature was employed to identify the symbionts and evaluate their spatial distribution on the host, their taxonomy, and their zoonotic potential. A total of five crayfish species were analyzed, with symbionts recorded across multiple body regions, particularly the chelipeds, gills, and pleopods. The most prevalent taxa belonged to the phyla Ciliophora, Annelida, and Platyhelminthes. Some symbionts, such as Xironogiton victoriensis and Uncinocythere occidentalis, were identified as obligate ectosymbionts that could have a negative impact on protected species such as Austropotamobius fulcisianus. Furthermore, several symbiont taxa (e.g., Fusarium sp., and Paragonimus spp.) are known to be zoonotic and are associated with conditions such as keratitis, onychomycosis, and paragonimiasis. The results highlight the dual ecological and epidemiological risk posed by crayfish invasions. As vectors of both invasive symbionts and zoonotic agents, these crustaceans may facilitate the emergence of new infectious diseases in freshwater environments. This underscores the need for integrated monitoring strategies that consider symbiont-host dynamics in invasive species management and public health surveillance and highlights the importance of implementing targeted management actions to mitigate ecological impacts and reduce associated health risks.},
}
RevDate: 2026-03-15
CmpDate: 2026-03-15
Tetranychus evansi (Tetranychidae) spider mites now a major solanaceous crop pest in Côte d'Ivoire.
Experimental & applied acarology, 96(3):.
The West African market gardening sector has been plagued in recent decades by phytophagous mite damage to solanaceous crops. Recent studies in Benin and Burkina Faso have confirmed West African outbreaks of red spider mites (Tetranychus evansi), a novel mite species native to South America, which has now virtually replaced local species. This study aimed to identify the different mite species infesting solanaceous crops in Côte d'Ivoire, while assessing their abundance and mapping their distributions. Tomato, eggplant and African eggplant crops were sampled along a north-south transect. Structured interviews were conducted to gather information on the crop protection practices. We confirmed the presence of the invasive species, Tetranychus evansi, with higher densities noted in the north, where the hot dry climatic conditions were suitable for its development. Local Tetranychus urticae and Polyphagotarsonemus latus species were not very abundant. The highest spider mite diversity was observed in the Abidjan area, where two new species of the T. urticae group were found. Very few Phytoseiidae predatory mites were present, even in plots that had barely been treated or not at all. Five species were identified: Neoseiulus barkeri, Neoseiulus teke, Amblyseius swirskii, Amblyseius tamatavensis, and Paraphytoseius horrifer. These predatory phytoseiid species seemed unable to control T. evansi populations. According to farmers, abamectin was the only pesticide effective for controlling these pests. To reduce the chemical control intensity, biological control based on the introduction and dissemination of a specific predatory mite such as Phytoseiulus longipes could be considered on a national and regional scale.
Additional Links: PMID-41832389
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41832389,
year = {2026},
author = {Deletre, E and Latapie, C and Migeon, A and Auger, P and Larpin, N and Laboisse, S and Martin, T},
title = {Tetranychus evansi (Tetranychidae) spider mites now a major solanaceous crop pest in Côte d'Ivoire.},
journal = {Experimental & applied acarology},
volume = {96},
number = {3},
pages = {},
pmid = {41832389},
issn = {1572-9702},
mesh = {Animals ; *Tetranychidae/physiology ; Cote d'Ivoire ; *Introduced Species ; Crops, Agricultural/growth & development ; Pest Control, Biological ; *Solanaceae/growth & development ; Population Density ; },
abstract = {The West African market gardening sector has been plagued in recent decades by phytophagous mite damage to solanaceous crops. Recent studies in Benin and Burkina Faso have confirmed West African outbreaks of red spider mites (Tetranychus evansi), a novel mite species native to South America, which has now virtually replaced local species. This study aimed to identify the different mite species infesting solanaceous crops in Côte d'Ivoire, while assessing their abundance and mapping their distributions. Tomato, eggplant and African eggplant crops were sampled along a north-south transect. Structured interviews were conducted to gather information on the crop protection practices. We confirmed the presence of the invasive species, Tetranychus evansi, with higher densities noted in the north, where the hot dry climatic conditions were suitable for its development. Local Tetranychus urticae and Polyphagotarsonemus latus species were not very abundant. The highest spider mite diversity was observed in the Abidjan area, where two new species of the T. urticae group were found. Very few Phytoseiidae predatory mites were present, even in plots that had barely been treated or not at all. Five species were identified: Neoseiulus barkeri, Neoseiulus teke, Amblyseius swirskii, Amblyseius tamatavensis, and Paraphytoseius horrifer. These predatory phytoseiid species seemed unable to control T. evansi populations. According to farmers, abamectin was the only pesticide effective for controlling these pests. To reduce the chemical control intensity, biological control based on the introduction and dissemination of a specific predatory mite such as Phytoseiulus longipes could be considered on a national and regional scale.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Tetranychidae/physiology
Cote d'Ivoire
*Introduced Species
Crops, Agricultural/growth & development
Pest Control, Biological
*Solanaceae/growth & development
Population Density
RevDate: 2026-03-15
Exotic wild boars consistently reduce superficial organic matter in Argentinean coastal herbaceous systems.
The Science of the total environment, 1025:181683 pii:S0048-9697(26)00344-X [Epub ahead of print].
Soils are major carbon reservoirs whose dynamics are regulated by the interaction of abiotic factors, soil properties, vegetation, and herbivores that control input and losses of soil organic matter (SOM), jointly determining if they act as carbon reservoirs (sinks) or carbon sources. Invasive species can disrupt that balance, potentially changing the system from sink to source. Within this framework, wild boars (Sus scrofa) act as ecosystem engineers that modify vegetation and soil properties through their rooting activity. Yet, their effects on carbon dynamics show contrasting patterns across ecosystems and remain unexplored in the coastal herbaceous systems of Argentina. Here, we evaluated the relationship between wild boar rooting and multiple ecosystem functions associated with carbon dynamics at three different herbaceous systems (a salt marsh, a grassland, and a coastal dune grassland). Using field surveys (comparing rooted and non-rooted areas) and experiments (with exclosures and control plots), we assessed the relationship between wild boar rooting and SOM. We also examined the association between wild boar activity and: (a) bare ground cover, (b) soil respiration, and (c) detritus decomposition rates across the three coastal herbaceous systems. Our results show that wild boar rooting consistently increased bare ground while reducing SOM content and soil respiration, but had no detectable effect on detritus decomposition. These consistent responses across ecosystems indicate an overall negative effect of rooting, suggesting that wild boars may reduce the capacity of coastal herbaceous systems to store soil carbon, with potential long-term consequences for carbon balance and ecosystem resilience.
Additional Links: PMID-41832861
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41832861,
year = {2026},
author = {Rocca, C and Diaz de Astarloa, C and Montemayor, DI and Daleo, P and Pascual, J and Bruschetti, CM and Iribarne, O and Alberti, J},
title = {Exotic wild boars consistently reduce superficial organic matter in Argentinean coastal herbaceous systems.},
journal = {The Science of the total environment},
volume = {1025},
number = {},
pages = {181683},
doi = {10.1016/j.scitotenv.2026.181683},
pmid = {41832861},
issn = {1879-1026},
abstract = {Soils are major carbon reservoirs whose dynamics are regulated by the interaction of abiotic factors, soil properties, vegetation, and herbivores that control input and losses of soil organic matter (SOM), jointly determining if they act as carbon reservoirs (sinks) or carbon sources. Invasive species can disrupt that balance, potentially changing the system from sink to source. Within this framework, wild boars (Sus scrofa) act as ecosystem engineers that modify vegetation and soil properties through their rooting activity. Yet, their effects on carbon dynamics show contrasting patterns across ecosystems and remain unexplored in the coastal herbaceous systems of Argentina. Here, we evaluated the relationship between wild boar rooting and multiple ecosystem functions associated with carbon dynamics at three different herbaceous systems (a salt marsh, a grassland, and a coastal dune grassland). Using field surveys (comparing rooted and non-rooted areas) and experiments (with exclosures and control plots), we assessed the relationship between wild boar rooting and SOM. We also examined the association between wild boar activity and: (a) bare ground cover, (b) soil respiration, and (c) detritus decomposition rates across the three coastal herbaceous systems. Our results show that wild boar rooting consistently increased bare ground while reducing SOM content and soil respiration, but had no detectable effect on detritus decomposition. These consistent responses across ecosystems indicate an overall negative effect of rooting, suggesting that wild boars may reduce the capacity of coastal herbaceous systems to store soil carbon, with potential long-term consequences for carbon balance and ecosystem resilience.},
}
RevDate: 2026-03-14
CmpDate: 2026-03-14
Monitoring the Spatiotemporal Dynamics of Invasive Pedicularis kansuensis in Bayinbuluke Alpine Wetlands: A Novel Spectral Index Framework Using PlanetScope Time Series (2021-2025).
Plants (Basel, Switzerland), 15(5): pii:plants15050806.
The expansion of the invasive species Pedicularis kansuensis threatens the ecological integrity of alpine wetlands, particularly in the Bayinbuluke, northwestern China. However, operational monitoring remains challenging. Conventional indices often lack specificity in heterogeneous alpine backgrounds, while deep learning models are typically too data-intensive to support consistent, multi-year mapping. To develop a rapid, reliable, and operational method for monitoring this invader, we proposed a novel, species-specific spectral index, the Pedicularis kansuensis Index (PKI), using the blue, green, and red-edge bands of high-resolution (3 m) PlanetScope imagery. The PKI constructs a robust target signal by integrating distinct spectral features derived from in situ hyperspectral measurement with a grayscale morphological opening (GrMO) refinement to suppress background noise. A comprehensive validation against seven established benchmarks indices (e.g., NDVI, RI, and ARI) demonstrated the superior performance of PKI across the central alpine wetlands of Bayinbuluke (2841 km[2]). It achieved the highest separability with an M-statistic of 1.36. Furthermore, the index attained an overall accuracy of 93.52% (95% CI: 92.3-94.7%), and an F1-score of 93.28% (95% CI: 92.0-94.5%), effectively minimizing confusion with co-occurring native vegetation and background. Applying this framework to a five-year time series (2021-2025) revealed a distinct cycle of outbreaks and relaxation. Specifically, the invaded area increased to 2168 ha in 2022, then decreased to 160 ha in 2025. Spatial analysis further identified stable invasion hotspots of 161.6 ha, highlighting key targets for long-term containment. Meanwhile, 94.4% of the invaded area was transient, lasting only one year (4824.7 ha). These results confirm that the PKI is a physically interpretable, accurate, and computationally efficient tool for monitoring invasive species in heterogeneous alpine environments. It facilitates timely and targeted ecosystem management.
Additional Links: PMID-41829837
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41829837,
year = {2026},
author = {Zhu, E and Samat, A and Li, W and Luo, K},
title = {Monitoring the Spatiotemporal Dynamics of Invasive Pedicularis kansuensis in Bayinbuluke Alpine Wetlands: A Novel Spectral Index Framework Using PlanetScope Time Series (2021-2025).},
journal = {Plants (Basel, Switzerland)},
volume = {15},
number = {5},
pages = {},
doi = {10.3390/plants15050806},
pmid = {41829837},
issn = {2223-7747},
support = {2022TSYCCX0006//Tianshan Talent Development Program/ ; 42371389//National Natural Science Foundation of China/ ; 2022-XBQNXZ-001//Western Young Scholars Project of the Chinese Academy of Sciences/ ; },
abstract = {The expansion of the invasive species Pedicularis kansuensis threatens the ecological integrity of alpine wetlands, particularly in the Bayinbuluke, northwestern China. However, operational monitoring remains challenging. Conventional indices often lack specificity in heterogeneous alpine backgrounds, while deep learning models are typically too data-intensive to support consistent, multi-year mapping. To develop a rapid, reliable, and operational method for monitoring this invader, we proposed a novel, species-specific spectral index, the Pedicularis kansuensis Index (PKI), using the blue, green, and red-edge bands of high-resolution (3 m) PlanetScope imagery. The PKI constructs a robust target signal by integrating distinct spectral features derived from in situ hyperspectral measurement with a grayscale morphological opening (GrMO) refinement to suppress background noise. A comprehensive validation against seven established benchmarks indices (e.g., NDVI, RI, and ARI) demonstrated the superior performance of PKI across the central alpine wetlands of Bayinbuluke (2841 km[2]). It achieved the highest separability with an M-statistic of 1.36. Furthermore, the index attained an overall accuracy of 93.52% (95% CI: 92.3-94.7%), and an F1-score of 93.28% (95% CI: 92.0-94.5%), effectively minimizing confusion with co-occurring native vegetation and background. Applying this framework to a five-year time series (2021-2025) revealed a distinct cycle of outbreaks and relaxation. Specifically, the invaded area increased to 2168 ha in 2022, then decreased to 160 ha in 2025. Spatial analysis further identified stable invasion hotspots of 161.6 ha, highlighting key targets for long-term containment. Meanwhile, 94.4% of the invaded area was transient, lasting only one year (4824.7 ha). These results confirm that the PKI is a physically interpretable, accurate, and computationally efficient tool for monitoring invasive species in heterogeneous alpine environments. It facilitates timely and targeted ecosystem management.},
}
RevDate: 2026-03-14
CmpDate: 2026-03-14
Temporal Floristic Changes (2005-2025) Along the Lower Stretch of the Tiber River (Central Italy).
Plants (Basel, Switzerland), 15(5): pii:plants15050716.
A multitemporal floristic study was conducted on the aquatic and riparian plant communities of the lower stretch of the Tiber River (central Italy) to identify any floristic changes in response to possible environmental pressures that have occurred locally over time. This investigation was carried out by comparing α- and temporal β-diversity, as well as biological, chorological, and ecological traits of plant assemblages present in permanent plots (n = 24) and sampled at two different time points (2005, 2025). Although both aquatic and riparian plant communities showed an increase in α-diversity over time (+94.1% and +56.5%, respectively), they generally exhibited different temporal patterns. The aquatic community showed a more stable floristic structure compared to the riparian one, with a persistent dominance of eutrophic and pollution-tolerant species, although local disappearance/rarefaction of some species was recorded. On the contrary, the riparian community showed greater species turnover, mainly due to an increase in generalist, ruderal and alien species, which over time have partially replaced those typically associated with riparian habitats. Ecological trait-based analyses indicated an increase over time in the percentage of thermophilous, heliophilous and nitrophilous species in both plant communities; the riparian community also showed an increase in xerophilous ones. Overall, the results indicate that aquatic and riparian communities exhibit distinct temporal dynamics within the same river system and highlight how long-term, permanent plot-based floristic monitoring is a useful tool in environmental studies.
Additional Links: PMID-41829746
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41829746,
year = {2026},
author = {Di Lernia, D and Zuccarello, V and Pinzani, L and Ceschin, S},
title = {Temporal Floristic Changes (2005-2025) Along the Lower Stretch of the Tiber River (Central Italy).},
journal = {Plants (Basel, Switzerland)},
volume = {15},
number = {5},
pages = {},
doi = {10.3390/plants15050716},
pmid = {41829746},
issn = {2223-7747},
abstract = {A multitemporal floristic study was conducted on the aquatic and riparian plant communities of the lower stretch of the Tiber River (central Italy) to identify any floristic changes in response to possible environmental pressures that have occurred locally over time. This investigation was carried out by comparing α- and temporal β-diversity, as well as biological, chorological, and ecological traits of plant assemblages present in permanent plots (n = 24) and sampled at two different time points (2005, 2025). Although both aquatic and riparian plant communities showed an increase in α-diversity over time (+94.1% and +56.5%, respectively), they generally exhibited different temporal patterns. The aquatic community showed a more stable floristic structure compared to the riparian one, with a persistent dominance of eutrophic and pollution-tolerant species, although local disappearance/rarefaction of some species was recorded. On the contrary, the riparian community showed greater species turnover, mainly due to an increase in generalist, ruderal and alien species, which over time have partially replaced those typically associated with riparian habitats. Ecological trait-based analyses indicated an increase over time in the percentage of thermophilous, heliophilous and nitrophilous species in both plant communities; the riparian community also showed an increase in xerophilous ones. Overall, the results indicate that aquatic and riparian communities exhibit distinct temporal dynamics within the same river system and highlight how long-term, permanent plot-based floristic monitoring is a useful tool in environmental studies.},
}
RevDate: 2026-03-14
CmpDate: 2026-03-14
Olfactory Cues in the Odour Plume of Predatory Fish Reduce Foraging and Elicit Anti-Predator Behaviour in the European Green Crab Carcinus maenas.
Animals : an open access journal from MDPI, 16(5): pii:ani16050828.
The European green crab (Carcinus maenas) is an intertidal crustacean that has extended its invasive range globally and is regarded as a major pest species for bivalves, impacting coastal food chains and aquacultures. Crabs primarily use chemosensory cues to sense their environment for feeding to avoid predation and to locate mates and induce mating. Consequently, known attractants including food baits are frequently employed in trapping and control efforts. Here, we investigate the effects of introducing a predatory fish odour to the environment and show that it elicits anti-predator behaviour in C. maenas. A 45% reduction in crab foraging and feeding behaviour was observed when predator odour was introduced compared with food control experiments. A further 23% reduction (68% reduction overall) in feeding behaviour was observed after crabs were exposed to (though housed separately from) the same seawater as the live predator for several days. This highlights the increased awareness or continuous stress of these habituated crabs towards predator odour. This study also presents potential for application as a deterrent in integrated pest management strategies for this global invader.
Additional Links: PMID-41829034
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41829034,
year = {2026},
author = {Burnett, JW and Ohnstad, H and Jones, AM and Hardege, JD and Bartels-Hardege, HD},
title = {Olfactory Cues in the Odour Plume of Predatory Fish Reduce Foraging and Elicit Anti-Predator Behaviour in the European Green Crab Carcinus maenas.},
journal = {Animals : an open access journal from MDPI},
volume = {16},
number = {5},
pages = {},
doi = {10.3390/ani16050828},
pmid = {41829034},
issn = {2076-2615},
abstract = {The European green crab (Carcinus maenas) is an intertidal crustacean that has extended its invasive range globally and is regarded as a major pest species for bivalves, impacting coastal food chains and aquacultures. Crabs primarily use chemosensory cues to sense their environment for feeding to avoid predation and to locate mates and induce mating. Consequently, known attractants including food baits are frequently employed in trapping and control efforts. Here, we investigate the effects of introducing a predatory fish odour to the environment and show that it elicits anti-predator behaviour in C. maenas. A 45% reduction in crab foraging and feeding behaviour was observed when predator odour was introduced compared with food control experiments. A further 23% reduction (68% reduction overall) in feeding behaviour was observed after crabs were exposed to (though housed separately from) the same seawater as the live predator for several days. This highlights the increased awareness or continuous stress of these habituated crabs towards predator odour. This study also presents potential for application as a deterrent in integrated pest management strategies for this global invader.},
}
RevDate: 2026-03-14
CmpDate: 2026-03-14
Environmental and Physiological Regulation of Reproduction in the Goldfish: Gonadal Development, Maturation, and Spawning Behavior: A Review.
Animals : an open access journal from MDPI, 16(5): pii:ani16050775.
The goldfish, a member of the Cyprinidae (minnow family) is an important and relevant model for understanding how fish function and reproduce and can be better managed. Here, we review recent studies of this species and its strengths as a model system. First, we review current understanding of how its neuroendocrine system regulates gonadotropin release, and then steroidogenesis and finally gonadal maturation in both males and females. Endocrine determinants of gender and sexual plasticity are described. Effects of the fish androgen, 11-ketotestosterone, on sexual and spawning behavior of males and females are reviewed. We also describe how several hormones (androstenedione, 17,20β-dihydroxy-4-pregen-3-one, prostaglandin F2α) and their metabolites function as "hormonal pheromones" to synchronize male-female spawning behavior and physiology. Insight provided by the goldfish has enhanced understanding of the neurobiology, toxicology, and comparative physiology of other fishes and provided lessons applicable to the culture of commercial carp and the control of invasive species, as well as conservation.
Additional Links: PMID-41828983
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41828983,
year = {2026},
author = {Kobayashi, M and Iwata, E and Sorensen, PW},
title = {Environmental and Physiological Regulation of Reproduction in the Goldfish: Gonadal Development, Maturation, and Spawning Behavior: A Review.},
journal = {Animals : an open access journal from MDPI},
volume = {16},
number = {5},
pages = {},
doi = {10.3390/ani16050775},
pmid = {41828983},
issn = {2076-2615},
abstract = {The goldfish, a member of the Cyprinidae (minnow family) is an important and relevant model for understanding how fish function and reproduce and can be better managed. Here, we review recent studies of this species and its strengths as a model system. First, we review current understanding of how its neuroendocrine system regulates gonadotropin release, and then steroidogenesis and finally gonadal maturation in both males and females. Endocrine determinants of gender and sexual plasticity are described. Effects of the fish androgen, 11-ketotestosterone, on sexual and spawning behavior of males and females are reviewed. We also describe how several hormones (androstenedione, 17,20β-dihydroxy-4-pregen-3-one, prostaglandin F2α) and their metabolites function as "hormonal pheromones" to synchronize male-female spawning behavior and physiology. Insight provided by the goldfish has enhanced understanding of the neurobiology, toxicology, and comparative physiology of other fishes and provided lessons applicable to the culture of commercial carp and the control of invasive species, as well as conservation.},
}
RevDate: 2026-03-14
CmpDate: 2026-03-14
Densification and Mechanical Enhancement of Invasive South African Hardwoods: Prosopis glandulosa and Acacia mearnsii.
Materials (Basel, Switzerland), 19(5): pii:ma19050954.
Wood used in construction varies in density, leading to differences in strength and rigidity. Wood densification has recently emerged as a promising technique to address these limitations and enhance material performance. This study explores the potential of two abundant and low-cost invasive hardwood species in South Africa-Prosopis glandulosa (Honey Mesquite) and Acacia mearnsii (Black Wattle)-as sources for producing densified wood. A range of strengthening methods, including chemical, pressure, and heat treatments, were applied and compared. After partial delignification and hot pressing, sample thicknesses were reduced by 40% for Prosopis and 50% for Acacia, yielding substantial increases in flexural strength of 216% (22.61 MPa) for Prosopis and 334% (24.65 MPa) for Acacia. In addition to anatomical imaging, analyses of lignosulphonate content, and thermogravimetric profiling, the study also evaluated several practical, carpentry-relevant mechanical properties. These included comparative tests for flexural and compressive strength, nailing and sanding performance, as well as assessments of water absorption, electrical resistivity, and flame-holding capacity.
Additional Links: PMID-41828222
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41828222,
year = {2026},
author = {Naghizadeh, M and Niemand, ME and Langner, EHG and Sivanda, AS and Eschwege, KGV},
title = {Densification and Mechanical Enhancement of Invasive South African Hardwoods: Prosopis glandulosa and Acacia mearnsii.},
journal = {Materials (Basel, Switzerland)},
volume = {19},
number = {5},
pages = {},
doi = {10.3390/ma19050954},
pmid = {41828222},
issn = {1996-1944},
support = {N/A//University of the Free State/ ; },
abstract = {Wood used in construction varies in density, leading to differences in strength and rigidity. Wood densification has recently emerged as a promising technique to address these limitations and enhance material performance. This study explores the potential of two abundant and low-cost invasive hardwood species in South Africa-Prosopis glandulosa (Honey Mesquite) and Acacia mearnsii (Black Wattle)-as sources for producing densified wood. A range of strengthening methods, including chemical, pressure, and heat treatments, were applied and compared. After partial delignification and hot pressing, sample thicknesses were reduced by 40% for Prosopis and 50% for Acacia, yielding substantial increases in flexural strength of 216% (22.61 MPa) for Prosopis and 334% (24.65 MPa) for Acacia. In addition to anatomical imaging, analyses of lignosulphonate content, and thermogravimetric profiling, the study also evaluated several practical, carpentry-relevant mechanical properties. These included comparative tests for flexural and compressive strength, nailing and sanding performance, as well as assessments of water absorption, electrical resistivity, and flame-holding capacity.},
}
RevDate: 2026-03-13
CmpDate: 2026-03-13
No evidence of increased mortality associated with Vespa velutina (Hymenoptera: Vespidae) spread in Spain.
Journal of medical entomology, 63(2):.
Subject Editor: Kristen Healy Global environmental change is reshaping species distributions worldwide, with direct implications for public health through altered patterns of arthropod exposure. Among Hymenoptera, the expansion of the yellow-legged hornet Vespa velutina nigrithorax du Buysson, 1905 has generated substantial concern, particularly in regions where the species is recently established. In Spain, this arrival has coincided with increased media attention and heightened public perception of danger, often accompanied by assumptions of rising mortality and escalating health risk. However, the true epidemiological impact of this invasion remains poorly quantified at the national scale. We conducted a retrospective analysis of officially certified deaths attributed to contact with hornets, wasps, and bees in Spain over a multi-decadal period spanning the establishment and spread of V. velutina. Overall, mortality associated with Hymenoptera exposure appeared stable over time and not altered during the period in which V. velutina became established. These findings suggest that invasion alone may not directly translate into measurable population-level lethality, highlighting the need to distinguish between increased encounter probability and the progression to fatal anaphylaxis. Continued surveillance, integration of clinical and ecological data, and accurate public communication will be essential for anticipating and responding to future shifts in risk under ongoing environmental change.
Additional Links: PMID-41824780
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41824780,
year = {2026},
author = {Herrera, C and Leza, M},
title = {No evidence of increased mortality associated with Vespa velutina (Hymenoptera: Vespidae) spread in Spain.},
journal = {Journal of medical entomology},
volume = {63},
number = {2},
pages = {},
doi = {10.1093/jme/tjag039},
pmid = {41824780},
issn = {1938-2928},
support = {POSTDOC2024_4//Margalida Comas/ ; PID2023-149487OA-I00//Margalida Comas/ ; MICIU/AEI/10.13039/501100011033//Margalida Comas/ ; ERDF/EU//Margalida Comas/ ; },
mesh = {Animals ; Spain ; *Wasps/physiology ; *Introduced Species ; Retrospective Studies ; Bees ; },
abstract = {Subject Editor: Kristen Healy Global environmental change is reshaping species distributions worldwide, with direct implications for public health through altered patterns of arthropod exposure. Among Hymenoptera, the expansion of the yellow-legged hornet Vespa velutina nigrithorax du Buysson, 1905 has generated substantial concern, particularly in regions where the species is recently established. In Spain, this arrival has coincided with increased media attention and heightened public perception of danger, often accompanied by assumptions of rising mortality and escalating health risk. However, the true epidemiological impact of this invasion remains poorly quantified at the national scale. We conducted a retrospective analysis of officially certified deaths attributed to contact with hornets, wasps, and bees in Spain over a multi-decadal period spanning the establishment and spread of V. velutina. Overall, mortality associated with Hymenoptera exposure appeared stable over time and not altered during the period in which V. velutina became established. These findings suggest that invasion alone may not directly translate into measurable population-level lethality, highlighting the need to distinguish between increased encounter probability and the progression to fatal anaphylaxis. Continued surveillance, integration of clinical and ecological data, and accurate public communication will be essential for anticipating and responding to future shifts in risk under ongoing environmental change.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
Spain
*Wasps/physiology
*Introduced Species
Retrospective Studies
Bees
RevDate: 2026-03-13
CmpDate: 2026-03-13
Global Suitable Habitats for Spodoptera litura and the Implications for Brazilian Agriculture.
Neotropical entomology, 55(1):.
Invasive alien species can significantly impact the environment, public health, and food production. Identifying high-risk areas is essential for implementing preventive measures, especially for species with several traits linked to invasive behavior, such as Spodoptera litura (F.). This study aimed to predict the potential global distribution of S. litura and assess its implications for five major crops in Brazil. Climatic suitability was estimated using the MaxEnt correlative algorithm, with fifty models generated by varying feature classes and regularization multiplier values. The best model selected based on the corrected Akaike Information Criterion demonstrated strong predictive performance, with high Area Under the Curve (AUCtrain = 0.92, AUCtest = 0.86) and Continuous Boyce Index (CBItrain = 0.95, CBItest = 0.75) values. Predictions identified highly and moderately suitable areas for S. litura across all continents, including regions where the species has not yet been recorded, such as the Neotropics. In Brazil, highly suitable areas include the mid-west, northeastern coast, and the southeastern and southern regions. Among the assessed crops, citrus (97.2%) had the greatest overlap with the suitable range for S. litura, followed by rice (94.2%), coffee (90.3%), and soybean (72.8%). These findings suggest that S. litura could cause significant economic damage if introduced and spread in Brazil. The results of this study can inform the development of preventive measures against the introduction and spread of this important agricultural pest, especially on high-risk areas near airports and seaports with intense international trade and in proximity to host crops.
Additional Links: PMID-41824159
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41824159,
year = {2026},
author = {da Silveira, LCL and Marchioro, CA},
title = {Global Suitable Habitats for Spodoptera litura and the Implications for Brazilian Agriculture.},
journal = {Neotropical entomology},
volume = {55},
number = {1},
pages = {},
pmid = {41824159},
issn = {1678-8052},
mesh = {Brazil ; Animals ; *Spodoptera ; *Agriculture ; *Ecosystem ; *Crops, Agricultural ; *Introduced Species ; },
abstract = {Invasive alien species can significantly impact the environment, public health, and food production. Identifying high-risk areas is essential for implementing preventive measures, especially for species with several traits linked to invasive behavior, such as Spodoptera litura (F.). This study aimed to predict the potential global distribution of S. litura and assess its implications for five major crops in Brazil. Climatic suitability was estimated using the MaxEnt correlative algorithm, with fifty models generated by varying feature classes and regularization multiplier values. The best model selected based on the corrected Akaike Information Criterion demonstrated strong predictive performance, with high Area Under the Curve (AUCtrain = 0.92, AUCtest = 0.86) and Continuous Boyce Index (CBItrain = 0.95, CBItest = 0.75) values. Predictions identified highly and moderately suitable areas for S. litura across all continents, including regions where the species has not yet been recorded, such as the Neotropics. In Brazil, highly suitable areas include the mid-west, northeastern coast, and the southeastern and southern regions. Among the assessed crops, citrus (97.2%) had the greatest overlap with the suitable range for S. litura, followed by rice (94.2%), coffee (90.3%), and soybean (72.8%). These findings suggest that S. litura could cause significant economic damage if introduced and spread in Brazil. The results of this study can inform the development of preventive measures against the introduction and spread of this important agricultural pest, especially on high-risk areas near airports and seaports with intense international trade and in proximity to host crops.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Brazil
Animals
*Spodoptera
*Agriculture
*Ecosystem
*Crops, Agricultural
*Introduced Species
RevDate: 2026-03-13
CmpDate: 2026-03-13
Integrated assessment of aquatic biota reveals ecological shifts and invasive trout reappearance in a post-flood Himalayan stream.
Environmental monitoring and assessment, 198(4):.
Freshwater ecosystems in the Himalayas are increasingly threatened by climate change, hydrological instability, and invasive species, yet the long-term ecological trajectories after major disturbance events remain poorly understood. This study examines post-flood environmental changes in the Assi Ganga River, a glacial tributary of the Bhagirathi, more than a decade after the catastrophic 2012-2013 flood that wiped out native and invasive fish populations, including Salmo trutta fario. From 2023 to 2024, we carried out integrated monitoring of macroinvertebrate communities, fish populations, and physicochemical parameters across three altitudinal sites (S1-S3). Water temperature increased downstream by about 1.2 °C, dissolved oxygen levels dropped accordingly, and turbidity peaked during the monsoon season. Macroinvertebrates showed signs of partial recovery, with 42 taxa recorded and a 7.3% increase in total abundance. Fish communities included seven cold-water species, with native Schizothorax spp. displaying strong numerical recovery, and invasive Salmo trutta fario reappearing across sites, likely due to recolonization from upstream refuges. Multivariate analyses revealed that temperature, DO, turbidity, and alkalinity collectively influenced both macroinvertebrate and fish communities, indicating shared environmental filters. The resurgence of S. trutta fario, potentially aided by recovering macroinvertebrate prey, raises concerns about renewed competitive pressure on native snow trout. This research highlights the importance of integrated, multi-trophic biomonitoring to understand resilience, restructuring, and invasion pathways in Himalayan river ecosystems.
Additional Links: PMID-41824124
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41824124,
year = {2026},
author = {Rana, D and Singh, N and Thapliyal, M and Thapliyal, A},
title = {Integrated assessment of aquatic biota reveals ecological shifts and invasive trout reappearance in a post-flood Himalayan stream.},
journal = {Environmental monitoring and assessment},
volume = {198},
number = {4},
pages = {},
pmid = {41824124},
issn = {1573-2959},
mesh = {Animals ; Rivers/chemistry ; *Introduced Species/statistics & numerical data ; *Environmental Monitoring ; *Trout ; Floods ; Ecosystem ; Climate Change ; India ; *Biota ; },
abstract = {Freshwater ecosystems in the Himalayas are increasingly threatened by climate change, hydrological instability, and invasive species, yet the long-term ecological trajectories after major disturbance events remain poorly understood. This study examines post-flood environmental changes in the Assi Ganga River, a glacial tributary of the Bhagirathi, more than a decade after the catastrophic 2012-2013 flood that wiped out native and invasive fish populations, including Salmo trutta fario. From 2023 to 2024, we carried out integrated monitoring of macroinvertebrate communities, fish populations, and physicochemical parameters across three altitudinal sites (S1-S3). Water temperature increased downstream by about 1.2 °C, dissolved oxygen levels dropped accordingly, and turbidity peaked during the monsoon season. Macroinvertebrates showed signs of partial recovery, with 42 taxa recorded and a 7.3% increase in total abundance. Fish communities included seven cold-water species, with native Schizothorax spp. displaying strong numerical recovery, and invasive Salmo trutta fario reappearing across sites, likely due to recolonization from upstream refuges. Multivariate analyses revealed that temperature, DO, turbidity, and alkalinity collectively influenced both macroinvertebrate and fish communities, indicating shared environmental filters. The resurgence of S. trutta fario, potentially aided by recovering macroinvertebrate prey, raises concerns about renewed competitive pressure on native snow trout. This research highlights the importance of integrated, multi-trophic biomonitoring to understand resilience, restructuring, and invasion pathways in Himalayan river ecosystems.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
Rivers/chemistry
*Introduced Species/statistics & numerical data
*Environmental Monitoring
*Trout
Floods
Ecosystem
Climate Change
India
*Biota
RevDate: 2026-03-13
A 2026 horizon scan for biodiversity conservation in South Africa.
Ambio [Epub ahead of print].
Horizon scans identify potential changes, enabling proactive rather than reactive conservation strategies. Here, in a follow up to the 2020 horizon scan, 14 biodiversity professionals from different sectors identify ten emerging issues potentially relevant to biodiversity conservation in South Africa over the next 5-10 years. The issues identified highlight three critical needs: adaptive governance systems, cross-sectoral collaboration capacity, and vigilance around new technologies that may simultaneously offer solutions and create new environmental pressures. We plotted these issues along axes of social agreement and scientific certainty, to ascertain whether issues might be "simple" (amenable to solutions from science alone), "complicated" (socially agreed upon but technically complicated), "complex" (scientifically challenging and condisderable levels of social disagreement) or "chaotic" (high social disagreement and highly scientifically challenging). Only one issue was likely to be addressed with improved science alone, but the remainder were all "complex", requiring social, economic and political engagement.
Additional Links: PMID-41824010
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41824010,
year = {2026},
author = {Seymour, CL and Tolley, KA and Zengeya, T and Spear, D and Cloete, JA and Dayaram, A and da Silva, JM and Alexander, GJ and Handley, K and Joseph, GS and Simba, LD and Snaddon, K and von Maltitz, GP and Carrick, PJ},
title = {A 2026 horizon scan for biodiversity conservation in South Africa.},
journal = {Ambio},
volume = {},
number = {},
pages = {},
pmid = {41824010},
issn = {1654-7209},
abstract = {Horizon scans identify potential changes, enabling proactive rather than reactive conservation strategies. Here, in a follow up to the 2020 horizon scan, 14 biodiversity professionals from different sectors identify ten emerging issues potentially relevant to biodiversity conservation in South Africa over the next 5-10 years. The issues identified highlight three critical needs: adaptive governance systems, cross-sectoral collaboration capacity, and vigilance around new technologies that may simultaneously offer solutions and create new environmental pressures. We plotted these issues along axes of social agreement and scientific certainty, to ascertain whether issues might be "simple" (amenable to solutions from science alone), "complicated" (socially agreed upon but technically complicated), "complex" (scientifically challenging and condisderable levels of social disagreement) or "chaotic" (high social disagreement and highly scientifically challenging). Only one issue was likely to be addressed with improved science alone, but the remainder were all "complex", requiring social, economic and political engagement.},
}
RevDate: 2026-03-13
CmpDate: 2026-03-13
Modeling species co-occurrence effects to inform invasive barred owl management and recovery of the northern spotted owl.
Ecological applications : a publication of the Ecological Society of America, 36(2):e70195.
Robust estimation of wildlife populations represents a cornerstone of wildlife research and provides critical information to guide management, including identifying at-risk species, setting harvest rates, and evaluating predator and invasive species control programs. Efforts to enhance population estimation have long included influences one species may have on another, beginning with direct effects of predation on prey populations. More recently, researchers have incorporated co-occurrence effects, such as fear of a competitor, into Lotka-Volterra competition models to generate more robust wildlife population estimates. Here, we introduce two modified Lotka-Volterra competition models, which incorporate one- and two-way co-occurrence effects, to estimate populations of two competing species. Using the test case of northern spotted (Strix occidentalis caurina) and barred owl (Strix varia) populations in the Pacific Northwest region of the United States, we evaluate if these new co-occurrence models can generate more robust population estimates than previous models. We then evaluate if potential co-occurrence effects among barred and northern spotted owls are uni- or bidirectional. Lastly, we leverage the best-performing model to evaluate the degree to which a recently proposed barred owl culling program may help recover northern spotted owl populations. Our model results suggest that incorporating co-occurrence effects improves model fit compared to classical Lotka-Volterra competition models. We found strong evidence for unidirectional co-occurrence effects of barred owls on northern spotted owls, but not vice versa. Our simulations of barred owl culling suggest that barred owls would need to be culled from approximately 40% of all occupied barred owl territories each year to reverse ongoing northern spotted owl population declines.
Additional Links: PMID-41821188
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41821188,
year = {2026},
author = {Srivastava, V and Van Lanen, NJ and Parshad, RD},
title = {Modeling species co-occurrence effects to inform invasive barred owl management and recovery of the northern spotted owl.},
journal = {Ecological applications : a publication of the Ecological Society of America},
volume = {36},
number = {2},
pages = {e70195},
doi = {10.1002/eap.70195},
pmid = {41821188},
issn = {1051-0761},
support = {//U.S. Geological Survey/ ; //Robert J. Lambert Graduate Assistantship/ ; },
mesh = {Animals ; *Strigiformes/physiology ; *Introduced Species ; *Models, Biological ; *Conservation of Natural Resources/methods ; Population Dynamics ; },
abstract = {Robust estimation of wildlife populations represents a cornerstone of wildlife research and provides critical information to guide management, including identifying at-risk species, setting harvest rates, and evaluating predator and invasive species control programs. Efforts to enhance population estimation have long included influences one species may have on another, beginning with direct effects of predation on prey populations. More recently, researchers have incorporated co-occurrence effects, such as fear of a competitor, into Lotka-Volterra competition models to generate more robust wildlife population estimates. Here, we introduce two modified Lotka-Volterra competition models, which incorporate one- and two-way co-occurrence effects, to estimate populations of two competing species. Using the test case of northern spotted (Strix occidentalis caurina) and barred owl (Strix varia) populations in the Pacific Northwest region of the United States, we evaluate if these new co-occurrence models can generate more robust population estimates than previous models. We then evaluate if potential co-occurrence effects among barred and northern spotted owls are uni- or bidirectional. Lastly, we leverage the best-performing model to evaluate the degree to which a recently proposed barred owl culling program may help recover northern spotted owl populations. Our model results suggest that incorporating co-occurrence effects improves model fit compared to classical Lotka-Volterra competition models. We found strong evidence for unidirectional co-occurrence effects of barred owls on northern spotted owls, but not vice versa. Our simulations of barred owl culling suggest that barred owls would need to be culled from approximately 40% of all occupied barred owl territories each year to reverse ongoing northern spotted owl population declines.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Strigiformes/physiology
*Introduced Species
*Models, Biological
*Conservation of Natural Resources/methods
Population Dynamics
RevDate: 2026-03-13
CmpDate: 2026-03-13
Assessing the environmental and dispersal-related drivers of an invasive aquatic plant in Great Lakes coastal wetlands.
Ecological applications : a publication of the Ecological Society of America, 36(2):e70206.
Invasive plant species pose a major threat to wetland ecosystems. One effective way to control the spread of invasive plants is to intercept them early in the invasion process. Species distribution models (SDMs), fit with covariates related to habitat suitability, can predict where new invasions are likely to occur. For species that have not yet filled their niches during early invasions, dispersal dynamics such as proximity to known presences and/or human vectors may control spread as much as habitat suitability. Yet, many SDMs assume that the species has filled its niche, incorporate only biophysical predictors, and do not consider spatial processes. Including dispersal dynamics can account for nonequilibrium processes, thereby improving the utility of invasive SDMs. We quantified the importance of environmental (abiotic and biotic) and dispersal-related drivers (anthropogenic and endogenous) on the occurrence and abundance of Hydrocharis morsus-ranae (European frogbit; EFB), a floating aquatic plant. We fit Bayesian hurdle models with integrated nested Laplace approximations (INLAs) to 2487 quadrat observations recorded across coastal wetlands in Michigan, USA from 2011 to 2021. We found that EFB occurrence was most strongly associated with distance to the nearest known population (m), a proxy of local dispersal. EFB occurrence also exhibited a nonlinear relationship with water depth (cm), demonstrating an optimal range of water depth for EFB. Occurrence was negatively associated with wave energy and positively associated with cattail (Typha spp.) abundance, which we attribute to protection from waves. Surprisingly, none of our predictors had any meaningful associations with EFB abundance, suggesting that it may be too early in EFB's invasion stage to quantify important drivers of abundance once at a site, or we did not include important factors that operate at the scale at which these growth processes occur. Moreover, the dispersal model yielded slightly better predictive capacity of EFB across Michigan. Overall, our results indicate that local dispersal is the primary driver of occurrence for an invasive species that has not yet filled its niche, whereas additional data or SDMs may be necessary to (a) better predict its abundance once established in coastal wetlands and (b) identify susceptible areas to future invasions.
Additional Links: PMID-41820262
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41820262,
year = {2026},
author = {Jochems, L and Requena-Mullor, JM and Brandt, J and Caughlin, TT and Monks, A and Hopping, K and Williamson, MA and Lishawa, SC},
title = {Assessing the environmental and dispersal-related drivers of an invasive aquatic plant in Great Lakes coastal wetlands.},
journal = {Ecological applications : a publication of the Ecological Society of America},
volume = {36},
number = {2},
pages = {e70206},
doi = {10.1002/eap.70206},
pmid = {41820262},
issn = {1051-0761},
support = {IS21-0307//Michigan Invasive Species Grant Program/ ; },
mesh = {*Wetlands ; *Introduced Species ; Michigan ; *Hydrocharitaceae/physiology ; Models, Biological ; Lakes ; *Plant Dispersal ; Bayes Theorem ; Seashore ; },
abstract = {Invasive plant species pose a major threat to wetland ecosystems. One effective way to control the spread of invasive plants is to intercept them early in the invasion process. Species distribution models (SDMs), fit with covariates related to habitat suitability, can predict where new invasions are likely to occur. For species that have not yet filled their niches during early invasions, dispersal dynamics such as proximity to known presences and/or human vectors may control spread as much as habitat suitability. Yet, many SDMs assume that the species has filled its niche, incorporate only biophysical predictors, and do not consider spatial processes. Including dispersal dynamics can account for nonequilibrium processes, thereby improving the utility of invasive SDMs. We quantified the importance of environmental (abiotic and biotic) and dispersal-related drivers (anthropogenic and endogenous) on the occurrence and abundance of Hydrocharis morsus-ranae (European frogbit; EFB), a floating aquatic plant. We fit Bayesian hurdle models with integrated nested Laplace approximations (INLAs) to 2487 quadrat observations recorded across coastal wetlands in Michigan, USA from 2011 to 2021. We found that EFB occurrence was most strongly associated with distance to the nearest known population (m), a proxy of local dispersal. EFB occurrence also exhibited a nonlinear relationship with water depth (cm), demonstrating an optimal range of water depth for EFB. Occurrence was negatively associated with wave energy and positively associated with cattail (Typha spp.) abundance, which we attribute to protection from waves. Surprisingly, none of our predictors had any meaningful associations with EFB abundance, suggesting that it may be too early in EFB's invasion stage to quantify important drivers of abundance once at a site, or we did not include important factors that operate at the scale at which these growth processes occur. Moreover, the dispersal model yielded slightly better predictive capacity of EFB across Michigan. Overall, our results indicate that local dispersal is the primary driver of occurrence for an invasive species that has not yet filled its niche, whereas additional data or SDMs may be necessary to (a) better predict its abundance once established in coastal wetlands and (b) identify susceptible areas to future invasions.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Wetlands
*Introduced Species
Michigan
*Hydrocharitaceae/physiology
Models, Biological
Lakes
*Plant Dispersal
Bayes Theorem
Seashore
RevDate: 2026-03-12
Introduced species: positive participants in contemporary ecosystems.
Trends in ecology & evolution pii:S0169-5347(26)00027-3 [Epub ahead of print].
Introduced species are usually viewed as major threats to biodiversity, yet growing evidence shows that their ecological roles are far more dynamic and complex. Recognizing introduced species as positive participants in contemporary ecosystems may help reconcile the long-standing paradox of biodiversity loss and shifts in ecosystem functioning under global change.
Additional Links: PMID-41820179
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41820179,
year = {2026},
author = {Chen, P and Siemann, E},
title = {Introduced species: positive participants in contemporary ecosystems.},
journal = {Trends in ecology & evolution},
volume = {},
number = {},
pages = {},
doi = {10.1016/j.tree.2026.02.001},
pmid = {41820179},
issn = {1872-8383},
abstract = {Introduced species are usually viewed as major threats to biodiversity, yet growing evidence shows that their ecological roles are far more dynamic and complex. Recognizing introduced species as positive participants in contemporary ecosystems may help reconcile the long-standing paradox of biodiversity loss and shifts in ecosystem functioning under global change.},
}
RevDate: 2026-03-12
Callinectes sapidus - coast to coast: Integrating stable isotope analysis and shotgun metagenomics to unravel trophic dynamics and microlitter ingestion across two Mediterranean sites.
Marine pollution bulletin, 227:119532 pii:S0025-326X(26)00319-X [Epub ahead of print].
The increasing presence of microlitter in the marine environment poses a growing threat to aquatic organisms. This study investigates microlitter ingestion and trophic ecology of Callinectes sapidus from two populations of the Mediterranean basin: the Adriatic and Tyrrhenian Seas. To disentangle potential differences in feeding strategies between the populations, we adopted an integrated framework combining stable isotope analysis with shotgun metagenomic analysis of gastrointestinal contents, thus providing a complementary view of long-term trophic position and short-term dietary composition. Gastrointestinal analysis revealed microlitter ingestion in 39% of Adriatic and 50% of Tyrrhenian individuals, with 123 particles retrieved. Fibres dominated (94.3%), though composition varied regionally: Adriatic individuals ingested mainly cellulose-based microlitter (62.5%), whereas Tyrrhenian ones mostly synthetic polymers (61.4%). Eight chemical types were identified, with cellulose, polyethylene terephthalate, and resin-based polymers most abundant. Stable isotope analysis (δ[15]N and δ[13]C) indicated distinct trophic patterns: Adriatic population had higher δ[15]N (mean ± sd: 11.50 ± 2.27‰) and less depleted δ[13]C (-16.20 ± 1.52‰) compared to the Tyrrhenian one (δ[15]N: 9.01 ± 2.27‰; δ[13]C: -18.57 ± 0.88‰), suggesting region-specific feeding strategies. Shotgun metagenomics provided complementary information on prey composition, helping to characterise the opportunistic diet of C. sapidus. Overall, these findings highlight spatial differences in microlitter exposure and trophic dynamics, likely shaped by environmental availability and feeding behaviour. By integrating microlitter ingestion, stable isotope analysis, and metagenomics, this study provides insight into how C. sapidus interacts with anthropogenic and natural resources, emphasizing the feeding flexibility underlying its invasive success in Mediterranean Sea.
Additional Links: PMID-41819697
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41819697,
year = {2026},
author = {Ciaralli, L and Valente, T and Monfardini, E and Berto, D and Rampazzo, F and Libralato, G and Manfra, L and Piermarini, R and Silvestri, C and Radicioli, M and Gioacchini, G and Chemello, G and Trotta, E and Capó, JD and Tomassetti, P and Matiddi, M},
title = {Callinectes sapidus - coast to coast: Integrating stable isotope analysis and shotgun metagenomics to unravel trophic dynamics and microlitter ingestion across two Mediterranean sites.},
journal = {Marine pollution bulletin},
volume = {227},
number = {},
pages = {119532},
doi = {10.1016/j.marpolbul.2026.119532},
pmid = {41819697},
issn = {1879-3363},
abstract = {The increasing presence of microlitter in the marine environment poses a growing threat to aquatic organisms. This study investigates microlitter ingestion and trophic ecology of Callinectes sapidus from two populations of the Mediterranean basin: the Adriatic and Tyrrhenian Seas. To disentangle potential differences in feeding strategies between the populations, we adopted an integrated framework combining stable isotope analysis with shotgun metagenomic analysis of gastrointestinal contents, thus providing a complementary view of long-term trophic position and short-term dietary composition. Gastrointestinal analysis revealed microlitter ingestion in 39% of Adriatic and 50% of Tyrrhenian individuals, with 123 particles retrieved. Fibres dominated (94.3%), though composition varied regionally: Adriatic individuals ingested mainly cellulose-based microlitter (62.5%), whereas Tyrrhenian ones mostly synthetic polymers (61.4%). Eight chemical types were identified, with cellulose, polyethylene terephthalate, and resin-based polymers most abundant. Stable isotope analysis (δ[15]N and δ[13]C) indicated distinct trophic patterns: Adriatic population had higher δ[15]N (mean ± sd: 11.50 ± 2.27‰) and less depleted δ[13]C (-16.20 ± 1.52‰) compared to the Tyrrhenian one (δ[15]N: 9.01 ± 2.27‰; δ[13]C: -18.57 ± 0.88‰), suggesting region-specific feeding strategies. Shotgun metagenomics provided complementary information on prey composition, helping to characterise the opportunistic diet of C. sapidus. Overall, these findings highlight spatial differences in microlitter exposure and trophic dynamics, likely shaped by environmental availability and feeding behaviour. By integrating microlitter ingestion, stable isotope analysis, and metagenomics, this study provides insight into how C. sapidus interacts with anthropogenic and natural resources, emphasizing the feeding flexibility underlying its invasive success in Mediterranean Sea.},
}
RevDate: 2026-03-12
CmpDate: 2026-03-12
Intraspecific variation in mating behaviour modulates the effects of mosquitofish introduction on prey communities.
Proceedings. Biological sciences, 293(2066):.
Intraspecific variation is recognized as a driver of ecological processes, yet prior studies have overwhelmingly focused on the ecological effects of intraspecific trait variation driven by natural selection. Far less is known about how variation in sexually selected traits influences ecological outcomes. In this study, we tested whether intraspecific differences in reproductive behaviours affect the ecosystem- and community-level impact of western mosquitofish (Gambusia affinis) introductions. Male mosquitofish frequently harass females through persistent mating attempts. We manipulated the intensity of male harassment and then used a mesocosm experiment to measure the ecological consequences of these differences in harassment. Although this behaviour manipulation was short-lived, our results suggest that differences in harassment intensity affected zooplankton communities. Compared to fish-absent controls, mesocosms with high-harassment males had smaller zooplankton body size and reduced abundance in several dominant taxa. These effects were not observed in low-harassment treatments, suggesting a threshold response in which only high-harassment males elicited community changes. The presence of mosquitofish also caused a trophic cascade to impact phytoplankton biomass; however, the strength of this cascade was not altered by harassment intensity. Our findings demonstrate that sexual selection can shape community composition and shows that reproductive behaviour can modulate the impact of species introduction.
Additional Links: PMID-41818812
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41818812,
year = {2026},
author = {Weiler, DE and Alonzo, SH and Palkovacs, EP},
title = {Intraspecific variation in mating behaviour modulates the effects of mosquitofish introduction on prey communities.},
journal = {Proceedings. Biological sciences},
volume = {293},
number = {2066},
pages = {},
doi = {10.1098/rspb.2025.2918},
pmid = {41818812},
issn = {1471-2954},
support = {//National Science Foundation/ ; },
mesh = {Animals ; Male ; *Cyprinodontiformes/physiology ; Female ; *Sexual Behavior, Animal ; Zooplankton/physiology ; *Food Chain ; *Introduced Species ; *Predatory Behavior ; },
abstract = {Intraspecific variation is recognized as a driver of ecological processes, yet prior studies have overwhelmingly focused on the ecological effects of intraspecific trait variation driven by natural selection. Far less is known about how variation in sexually selected traits influences ecological outcomes. In this study, we tested whether intraspecific differences in reproductive behaviours affect the ecosystem- and community-level impact of western mosquitofish (Gambusia affinis) introductions. Male mosquitofish frequently harass females through persistent mating attempts. We manipulated the intensity of male harassment and then used a mesocosm experiment to measure the ecological consequences of these differences in harassment. Although this behaviour manipulation was short-lived, our results suggest that differences in harassment intensity affected zooplankton communities. Compared to fish-absent controls, mesocosms with high-harassment males had smaller zooplankton body size and reduced abundance in several dominant taxa. These effects were not observed in low-harassment treatments, suggesting a threshold response in which only high-harassment males elicited community changes. The presence of mosquitofish also caused a trophic cascade to impact phytoplankton biomass; however, the strength of this cascade was not altered by harassment intensity. Our findings demonstrate that sexual selection can shape community composition and shows that reproductive behaviour can modulate the impact of species introduction.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
Male
*Cyprinodontiformes/physiology
Female
*Sexual Behavior, Animal
Zooplankton/physiology
*Food Chain
*Introduced Species
*Predatory Behavior
RevDate: 2026-03-12
CmpDate: 2026-03-12
Spatial coexistence of invasive ants in fragmented urban habitats of their native range.
Frontiers in insect science, 6:1776153.
INTRODUCTION: Urban landscapes are increasingly recognized as key arenas for biological invasions, yet the mechanisms enabling the local coexistence of multiple highly invasive species remain poorly understood. Urban habitat fragmentation generates mosaics of habitat patches that differ in size, isolation, and microhabitat complexity, shaping ant community structure and competitive interactions.
METHODS: Here, we investigated ant assemblages across a mosaic of urban habitat patches within a university campus in Buenos Aires, Argentina, focusing on four globally invasive ant species (Wasmannia auropunctata, Linepithema humile, Nylanderia fulva, and Solenopsis invicta) near the southern limit of their native ranges. We quantified species richness, abundance and composition using pitfall traps and evaluated species-specific indicators of food discovery, recruitment, and dominance using standardized bait experiments.
RESULTS: Ant assemblages differed significantly among habitat patches, with marked spatial variation in richness, diversity, and species composition. Contrary to expectations of rigid dominance hierarchies, no single species consistently dominated across patches. Nylanderia fulva showed the highest numerical abundance and discovery efficiency, L. humile exhibited the strongest recruitment ability, and W. auropunctata displayed localized dominance near nesting areas, while S. invicta was rare and competitively subordinate. Ordination and multivariate analyses indicated strong spatial structuring of assemblages, consistent with the influence of urban fragmentation and patch-level heterogeneity.
DISCUSSION/CONCLUSION: Overall, our results support a metacommunity perspective in which invasive ant coexistence in urban systems is mediated by context-dependent competitive interactions rather than fixed dominance hierarchies. By emphasizing the role of fine-scale spatial structure, this study provides a nuanced, system-specific contribution to understanding invasive ant dynamics in urban environments.
Additional Links: PMID-41815923
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41815923,
year = {2026},
author = {Muñoz, IJ and Alvarez Costa, A and Schilman, PE and Calcaterra, LA},
title = {Spatial coexistence of invasive ants in fragmented urban habitats of their native range.},
journal = {Frontiers in insect science},
volume = {6},
number = {},
pages = {1776153},
pmid = {41815923},
issn = {2673-8600},
abstract = {INTRODUCTION: Urban landscapes are increasingly recognized as key arenas for biological invasions, yet the mechanisms enabling the local coexistence of multiple highly invasive species remain poorly understood. Urban habitat fragmentation generates mosaics of habitat patches that differ in size, isolation, and microhabitat complexity, shaping ant community structure and competitive interactions.
METHODS: Here, we investigated ant assemblages across a mosaic of urban habitat patches within a university campus in Buenos Aires, Argentina, focusing on four globally invasive ant species (Wasmannia auropunctata, Linepithema humile, Nylanderia fulva, and Solenopsis invicta) near the southern limit of their native ranges. We quantified species richness, abundance and composition using pitfall traps and evaluated species-specific indicators of food discovery, recruitment, and dominance using standardized bait experiments.
RESULTS: Ant assemblages differed significantly among habitat patches, with marked spatial variation in richness, diversity, and species composition. Contrary to expectations of rigid dominance hierarchies, no single species consistently dominated across patches. Nylanderia fulva showed the highest numerical abundance and discovery efficiency, L. humile exhibited the strongest recruitment ability, and W. auropunctata displayed localized dominance near nesting areas, while S. invicta was rare and competitively subordinate. Ordination and multivariate analyses indicated strong spatial structuring of assemblages, consistent with the influence of urban fragmentation and patch-level heterogeneity.
DISCUSSION/CONCLUSION: Overall, our results support a metacommunity perspective in which invasive ant coexistence in urban systems is mediated by context-dependent competitive interactions rather than fixed dominance hierarchies. By emphasizing the role of fine-scale spatial structure, this study provides a nuanced, system-specific contribution to understanding invasive ant dynamics in urban environments.},
}
RevDate: 2026-03-12
CmpDate: 2026-03-12
The first dataset of de novo assembled transcriptome of Aspidiotus destructor Signoret (Hemiptera: Diaspididae).
Data in brief, 65:112619.
Coconut, Cocos nucifera L., is the top agricultural export of the Philippines with about 1.2 billion pesos in value. The Philippine coconut industry, however, has been under major threat from an outbreak of the armored coconut scale insects. There are two species believed to cause an outbreak: Aspidiotus destructor Signoret and Aspidiotus rigidus Reyne. These are sibling species and are hard to differentiate using morphological identification. In fact, A. rigidus was once thought to be a subspecies of A. destructor and was misidentified as A. destructor during the early phases of the coconut scale insect outbreak because it is the only known species native to the Philippines. Aspidiotus rigidus has recently been identified as an invasive species and found to be the cause of the outbreak. The native species A. destructor should not be overlooked as a subject of research since it is still present alongside the A. rigidus, and it continues to infest several perennial crops. The need for a research approach of these insects at the molecular level has required the use of transcriptomics. Transcriptome datasets offer a way at investigating how genes are expressed, how species differ from each other, and how phenotypes came to be, among others. Transcriptomics offers such deeper understanding and can be used to develop methods for pest management. Because A. rigidus transcriptome has recently become available, it is imperative to have the dataset for its sibling species, A. destructor. This serves as a foundational resource; the first publicly available transcriptome assembly for the species. This will provide additional knowledge on how the two sibling species differ and assess their capacity to cause outbreak. The data here represents the first transcriptome profile of the A. destructor using Illumina HiSeq 4000 paired- end sequencing. Pair-end reads were assembled de novo with Trinity. Raw fastq reads have been deposited in NCBI-SRA (SRR17085744 and SRR17085743). The Trinity-based transcriptome assembly have also been deposited in the NCBI-SRA (SUB10341747). Two additional assemblies were also generated and have been deposited in NCBI-SRA: an assembly clustered using CD-HIT-EST (SUB10341752) and an assembly sorted according to its longest assembly via a custom script (SUB10341753).
Additional Links: PMID-41815798
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41815798,
year = {2026},
author = {Geronca, J and Egana, JMC and Cleofe, MAS and Bautista, MAM},
title = {The first dataset of de novo assembled transcriptome of Aspidiotus destructor Signoret (Hemiptera: Diaspididae).},
journal = {Data in brief},
volume = {65},
number = {},
pages = {112619},
pmid = {41815798},
issn = {2352-3409},
abstract = {Coconut, Cocos nucifera L., is the top agricultural export of the Philippines with about 1.2 billion pesos in value. The Philippine coconut industry, however, has been under major threat from an outbreak of the armored coconut scale insects. There are two species believed to cause an outbreak: Aspidiotus destructor Signoret and Aspidiotus rigidus Reyne. These are sibling species and are hard to differentiate using morphological identification. In fact, A. rigidus was once thought to be a subspecies of A. destructor and was misidentified as A. destructor during the early phases of the coconut scale insect outbreak because it is the only known species native to the Philippines. Aspidiotus rigidus has recently been identified as an invasive species and found to be the cause of the outbreak. The native species A. destructor should not be overlooked as a subject of research since it is still present alongside the A. rigidus, and it continues to infest several perennial crops. The need for a research approach of these insects at the molecular level has required the use of transcriptomics. Transcriptome datasets offer a way at investigating how genes are expressed, how species differ from each other, and how phenotypes came to be, among others. Transcriptomics offers such deeper understanding and can be used to develop methods for pest management. Because A. rigidus transcriptome has recently become available, it is imperative to have the dataset for its sibling species, A. destructor. This serves as a foundational resource; the first publicly available transcriptome assembly for the species. This will provide additional knowledge on how the two sibling species differ and assess their capacity to cause outbreak. The data here represents the first transcriptome profile of the A. destructor using Illumina HiSeq 4000 paired- end sequencing. Pair-end reads were assembled de novo with Trinity. Raw fastq reads have been deposited in NCBI-SRA (SRR17085744 and SRR17085743). The Trinity-based transcriptome assembly have also been deposited in the NCBI-SRA (SUB10341747). Two additional assemblies were also generated and have been deposited in NCBI-SRA: an assembly clustered using CD-HIT-EST (SUB10341752) and an assembly sorted according to its longest assembly via a custom script (SUB10341753).},
}
RevDate: 2026-03-12
CmpDate: 2026-03-12
Survey of Synanthropic Spiders in Ireland Reveals Expansion and Dominance of the Invasive Noble False Widow Steatoda nobilis in Urban Habitats (Araneae: Theridiidae).
Ecology and evolution, 16(3):e73193.
Rapid urbanisation has led several spider species to adapt to synanthropic microhabitats and establish large populations outside of their native ranges. In Ireland, the establishment and widespread distribution of the Noble false widow spider Steatoda nobilis (Araneae: Theridiidae) (Thorell, 1875) has raised questions about its impact on native spider populations across the country. Through an extensive field survey of six urban centres over an 11-month period, we sought to establish population demographics for S. nobilis and other synanthropic spiders in Ireland for the first time. We surveyed fence microhabitats for both spider abundance and diversity to determine the influence of variables such as prey availability and climate. Of the 20 identifiable species observed, S. nobilis and the missing sector orb weaver Zygiella x-notata (Clerck, 1757) typically made up more than 80% of the spider abundance regardless of location surveyed, including two new Irish counties where S. nobilis had previously not been recorded but is now well established (Co. Mayo and Co. Sligo). Our results also indicated that the diversity of synanthropic spiders is significantly affected by seasonality and prey availability, but largely unaffected by daily weather conditions.
Additional Links: PMID-41815292
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41815292,
year = {2026},
author = {Collier, BL and Leonard, D and Lyons, K and Dunbar, JP and Lawton, C and Dugon, MM},
title = {Survey of Synanthropic Spiders in Ireland Reveals Expansion and Dominance of the Invasive Noble False Widow Steatoda nobilis in Urban Habitats (Araneae: Theridiidae).},
journal = {Ecology and evolution},
volume = {16},
number = {3},
pages = {e73193},
pmid = {41815292},
issn = {2045-7758},
abstract = {Rapid urbanisation has led several spider species to adapt to synanthropic microhabitats and establish large populations outside of their native ranges. In Ireland, the establishment and widespread distribution of the Noble false widow spider Steatoda nobilis (Araneae: Theridiidae) (Thorell, 1875) has raised questions about its impact on native spider populations across the country. Through an extensive field survey of six urban centres over an 11-month period, we sought to establish population demographics for S. nobilis and other synanthropic spiders in Ireland for the first time. We surveyed fence microhabitats for both spider abundance and diversity to determine the influence of variables such as prey availability and climate. Of the 20 identifiable species observed, S. nobilis and the missing sector orb weaver Zygiella x-notata (Clerck, 1757) typically made up more than 80% of the spider abundance regardless of location surveyed, including two new Irish counties where S. nobilis had previously not been recorded but is now well established (Co. Mayo and Co. Sligo). Our results also indicated that the diversity of synanthropic spiders is significantly affected by seasonality and prey availability, but largely unaffected by daily weather conditions.},
}
RevDate: 2026-03-12
CmpDate: 2026-03-12
Intra- and Inter-Specific Ecological Impacts Vary Across a Gradient of Abundance of an Invasive Species, Bothriochloa ischaemum, in a Mixed-Grass Prairie.
Ecology and evolution, 16(3):e73212.
Managing biological invasions is one of the top priorities of biodiversity conservation. Invasive plants are a well-known threat to native plant and animal communities, and understanding their ecological impacts is critical to developing individualized management strategies. While much is known about the impacts of invasive plants, there are still questions about the per capita effects along invasion abundance gradients across levels of biological organization. In this study we investigate how the ecological impacts of the invasive grass Bothriochloa ischaemum vary across a gradient of invasion and whether effects are consistent across population (abundance and functional traits of a dominant native grass, Schizachyrium scoparium) and community (species richness and composition) levels. We found that most of the ecological impacts of B. ischaemum scale linearly with its abundance across population and community levels. Increasing invasion reduces the height and abundance of the dominant native S. scoparium individuals and shifts their functional trait composition. Increasing invasion also reduces cover of native C3 and C4 grasses, total foliar cover, subdominant foliar cover, species richness, and leads to shifts in species and functional group composition. However, the impact on legume abundance saturated at low invader abundance (1%-15% cover) and remained constant as invader abundance increased. We show that the direct ecological impacts of invasive species may be compounded by shifts in the functional traits of dominant native species toward more conservative traits and shifts in species and functional group composition, leading toward a shift in population and community structure and function.
Additional Links: PMID-41815290
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41815290,
year = {2026},
author = {Kouri, JD and Rust, E and Souza, L},
title = {Intra- and Inter-Specific Ecological Impacts Vary Across a Gradient of Abundance of an Invasive Species, Bothriochloa ischaemum, in a Mixed-Grass Prairie.},
journal = {Ecology and evolution},
volume = {16},
number = {3},
pages = {e73212},
pmid = {41815290},
issn = {2045-7758},
abstract = {Managing biological invasions is one of the top priorities of biodiversity conservation. Invasive plants are a well-known threat to native plant and animal communities, and understanding their ecological impacts is critical to developing individualized management strategies. While much is known about the impacts of invasive plants, there are still questions about the per capita effects along invasion abundance gradients across levels of biological organization. In this study we investigate how the ecological impacts of the invasive grass Bothriochloa ischaemum vary across a gradient of invasion and whether effects are consistent across population (abundance and functional traits of a dominant native grass, Schizachyrium scoparium) and community (species richness and composition) levels. We found that most of the ecological impacts of B. ischaemum scale linearly with its abundance across population and community levels. Increasing invasion reduces the height and abundance of the dominant native S. scoparium individuals and shifts their functional trait composition. Increasing invasion also reduces cover of native C3 and C4 grasses, total foliar cover, subdominant foliar cover, species richness, and leads to shifts in species and functional group composition. However, the impact on legume abundance saturated at low invader abundance (1%-15% cover) and remained constant as invader abundance increased. We show that the direct ecological impacts of invasive species may be compounded by shifts in the functional traits of dominant native species toward more conservative traits and shifts in species and functional group composition, leading toward a shift in population and community structure and function.},
}
RevDate: 2026-03-12
Tidal marsh species mapping using commercial satellite imagery for enhanced coastal management in Chesapeake Bay.
Remote sensing applications : society and environment, 41:101902.
Tidal marshes offer numerous ecological and economic benefits but are threatened by human development, sea-level rise, and invasive species. Routine mapping of their species composition is crucial for coastal management, yet current efforts are spatially and temporally limited and lack species identification. To address this, we used 3-m PlanetScope satellite imagery to classify four common marsh plants across Virginia's Middle Peninsula in Chesapeake Bay, a region targeted for restoration given its ecological and economic significance. We developed a random forest classifier using May 2021 reference data from the Virginia Institute of Marine Science, delineating Spartina alterniflora, Phragmites australis, Spartina patens, and Juncus roemerianus at eight marshes. Balanced agreement was strong at 93%, ranging from 63% to 98% across individual marshes. We then expanded to the broader Middle Peninsula, using the Mann-Whitney U test to compare satellite- and reference-derived coverage of P. australis, finding moderate agreement despite a large temporal offset (r rb = 0.45; N = 152). Following suitable model performance, we generated annual assessments for May 2021-2024. S. alterniflora was most extensively distributed, covering half of our study area. We also analyzed random forest class probabilities to inform data collection and model interpretation. Probabilities were generally above 0.6, although those accompanying J. roemerianus were notably lower. We present methods for large-scale species mapping to inform resource prioritization and coastal management, including a framework for communicating classification certainty, which is adaptable to stakeholder needs. Our framework can be used to retrain our classification model for application elsewhere, where local field data is available.
Additional Links: PMID-41815179
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41815179,
year = {2026},
author = {Coffer, MM and Trinh, R and Mitchell, M and Angstadt, K and Stanhope, D and Lv, Z and Nunez, K and Bartlett, ND and Wiltsie, D and Sullivan, S and Schaeffer, BA},
title = {Tidal marsh species mapping using commercial satellite imagery for enhanced coastal management in Chesapeake Bay.},
journal = {Remote sensing applications : society and environment},
volume = {41},
number = {},
pages = {101902},
pmid = {41815179},
issn = {2352-9385},
abstract = {Tidal marshes offer numerous ecological and economic benefits but are threatened by human development, sea-level rise, and invasive species. Routine mapping of their species composition is crucial for coastal management, yet current efforts are spatially and temporally limited and lack species identification. To address this, we used 3-m PlanetScope satellite imagery to classify four common marsh plants across Virginia's Middle Peninsula in Chesapeake Bay, a region targeted for restoration given its ecological and economic significance. We developed a random forest classifier using May 2021 reference data from the Virginia Institute of Marine Science, delineating Spartina alterniflora, Phragmites australis, Spartina patens, and Juncus roemerianus at eight marshes. Balanced agreement was strong at 93%, ranging from 63% to 98% across individual marshes. We then expanded to the broader Middle Peninsula, using the Mann-Whitney U test to compare satellite- and reference-derived coverage of P. australis, finding moderate agreement despite a large temporal offset (r rb = 0.45; N = 152). Following suitable model performance, we generated annual assessments for May 2021-2024. S. alterniflora was most extensively distributed, covering half of our study area. We also analyzed random forest class probabilities to inform data collection and model interpretation. Probabilities were generally above 0.6, although those accompanying J. roemerianus were notably lower. We present methods for large-scale species mapping to inform resource prioritization and coastal management, including a framework for communicating classification certainty, which is adaptable to stakeholder needs. Our framework can be used to retrain our classification model for application elsewhere, where local field data is available.},
}
RevDate: 2026-03-12
Occurrence and environmental data for aquatic plants of Minnesota from 1999-2018.
Scientific data pii:10.1038/s41597-026-07027-3 [Epub ahead of print].
The aquatic flora of Minnesota's freshwater lakes have been extensively surveyed for purposes of resource assessment, research, and ecosystem management. Despite widespread use of a common method for vegetation sampling ("point-intercept surveys"), these records have existed to-date in disparate locations without unification. Here we present a first-of-its-kind dataset of point-level occurrences, relative abundances, and associated environmental data for macrophytes (freshwater plants) across Minnesota. The data encompass 3,194 surveys of 1,520 lakes and ponds performed over a 19-year timespan. A total of 367,382 points were sampled, across which 231 taxa were recorded. Macrophyte occurrence data and depth, as well as point-level relative-plant-abundance measures for a subset of surveys, were collated, cleaned, and joined to geospatial data and Secchi-depth measurements of water clarity, enabling light availability, a primary control on aquatic plant growth, to be estimated. The data are well-suited for ecological analyses across multiple spatial scales and can be used to address both fundamental and applied ecological questions.
Additional Links: PMID-41813674
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41813674,
year = {2026},
author = {Verhoeven, MR and Bartodziej, WL and Berg, MS and Blood, S and Crabb, R and Fieldseth, E and Johnson, JA and Marty, J and McComas, S and Newman, RM and Rattei, M and Sweet, JB and Townsend, J and Vlach, B and Valenty, J and Spetzman, JP and Witkowski, SW and Prichard, A and Glisson, WJ and Larkin, DJ},
title = {Occurrence and environmental data for aquatic plants of Minnesota from 1999-2018.},
journal = {Scientific data},
volume = {},
number = {},
pages = {},
doi = {10.1038/s41597-026-07027-3},
pmid = {41813674},
issn = {2052-4463},
support = {CON-75851, project 00074041//National Science Foundation (NSF)/ ; },
abstract = {The aquatic flora of Minnesota's freshwater lakes have been extensively surveyed for purposes of resource assessment, research, and ecosystem management. Despite widespread use of a common method for vegetation sampling ("point-intercept surveys"), these records have existed to-date in disparate locations without unification. Here we present a first-of-its-kind dataset of point-level occurrences, relative abundances, and associated environmental data for macrophytes (freshwater plants) across Minnesota. The data encompass 3,194 surveys of 1,520 lakes and ponds performed over a 19-year timespan. A total of 367,382 points were sampled, across which 231 taxa were recorded. Macrophyte occurrence data and depth, as well as point-level relative-plant-abundance measures for a subset of surveys, were collated, cleaned, and joined to geospatial data and Secchi-depth measurements of water clarity, enabling light availability, a primary control on aquatic plant growth, to be estimated. The data are well-suited for ecological analyses across multiple spatial scales and can be used to address both fundamental and applied ecological questions.},
}
RevDate: 2026-03-11
Behavioral and physiological dynamics of a native minnow exposed to invasive fish species.
Physiology & behavior pii:S0031-9384(26)00082-X [Epub ahead of print].
The introduction of invasive alien species is a major threat to freshwater biodiversity, particularly in Mediterranean ecosystems where seasonal droughts increase population density and social stress. This study investigated the effects of the presence and of variables densities of two widespread invasive fish species Gambusia holbrooki (Girard, 1859) and Lepomis gibbosus (Linnaeus, 1758), on the behaviour and physiology of the Iberian endemic Squalius alburnoides (Steindachner, 1866). Under baseline density, exposure to G. holbrooki significantly altered the behaviour of S. alburnoides, leading to increased aggression towards conspecifics, enhanced evasion, and a rise in the number of attacks suffered. These behavioral changes were accompanied by a reduction in forebrain dopamine levels, suggesting that dopaminergic influence in stress-related responses. In contrast, interactions with L. gibbosus under the same conditions did not produce significant behavioral or physiological effects, although conspecific aggression showed temporal fluctuations. Under high-density conditions, both invaders intensified antagonistic interactions with S. alburnoides. Significant neurochemical alterations occurred solely in fish exposed to G. holbrooki, which showed elevated 5-HIAA concentrations and increased DOPAC/DA and 5-HIAA/5-HT ratios, indicating activation of serotonergic and dopaminergic pathways. Unexpectedly, plasma cortisol levels in S. alburnoides decreased in the presence of both invader species, suggesting a possible downregulation of the hypothalamic-pituitary-interrenal axis under putative social stress. Overall, our results demonstrate that invasives differentially modulate behavioral and physiological stress responses in S. alburnoides, with G. holbrooki exerting stronger effects than L. gibbosus, and that higher densities amplify these species-specific interactions.
Additional Links: PMID-41812963
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41812963,
year = {2026},
author = {Luiz, M and Banha, F and Brito, G and Cambiaghi E Silva, B and Anastácio, P and Gesto, M and Soares, MC},
title = {Behavioral and physiological dynamics of a native minnow exposed to invasive fish species.},
journal = {Physiology & behavior},
volume = {},
number = {},
pages = {115298},
doi = {10.1016/j.physbeh.2026.115298},
pmid = {41812963},
issn = {1873-507X},
abstract = {The introduction of invasive alien species is a major threat to freshwater biodiversity, particularly in Mediterranean ecosystems where seasonal droughts increase population density and social stress. This study investigated the effects of the presence and of variables densities of two widespread invasive fish species Gambusia holbrooki (Girard, 1859) and Lepomis gibbosus (Linnaeus, 1758), on the behaviour and physiology of the Iberian endemic Squalius alburnoides (Steindachner, 1866). Under baseline density, exposure to G. holbrooki significantly altered the behaviour of S. alburnoides, leading to increased aggression towards conspecifics, enhanced evasion, and a rise in the number of attacks suffered. These behavioral changes were accompanied by a reduction in forebrain dopamine levels, suggesting that dopaminergic influence in stress-related responses. In contrast, interactions with L. gibbosus under the same conditions did not produce significant behavioral or physiological effects, although conspecific aggression showed temporal fluctuations. Under high-density conditions, both invaders intensified antagonistic interactions with S. alburnoides. Significant neurochemical alterations occurred solely in fish exposed to G. holbrooki, which showed elevated 5-HIAA concentrations and increased DOPAC/DA and 5-HIAA/5-HT ratios, indicating activation of serotonergic and dopaminergic pathways. Unexpectedly, plasma cortisol levels in S. alburnoides decreased in the presence of both invader species, suggesting a possible downregulation of the hypothalamic-pituitary-interrenal axis under putative social stress. Overall, our results demonstrate that invasives differentially modulate behavioral and physiological stress responses in S. alburnoides, with G. holbrooki exerting stronger effects than L. gibbosus, and that higher densities amplify these species-specific interactions.},
}
RevDate: 2026-03-11
CmpDate: 2026-03-12
Cross attraction to various Spodoptera species using pheromone lures for native and exotic species.
Environmental entomology, 55(2):.
Previous research showed that the pheromone lure commercially formulated and produced for the exotic species Spodoptera exempta (Walker) also captured 2 native species, Spodoptera albula (Walker) and Spodoptera latifascia (Walker). This study expanded that work to identify the Spodoptera species that were attracted to lures specifically formulated for S. albula, Spodoptera cosmioides (Walker), Spodoptera eridania (Stoll in Cramer), Spodoptera exempta (Walker), Spodoptera exigua (Hübner), Spodoptera frugiperda (J. E. Smith), S. latifascia, Spodoptera litura (F.), and Spodoptera mauritia (Boisduval). In all trapping sites in Texas and Florida, S. exempta lures attracted S. latifascia and S. albula moths, sometimes at densities of over 80 moths per night. These lures, along with those designed for S. latifascia and S. albula, provided seasonal information for other Spodoptera species that are not routinely monitored. Lures for the South American species S. cosmioides consistently attracted the native non-pest Spodoptera dolichos (F.). Lures formulated for Spodoptera littoralis (Boisduval) from the Old World and S. litura from Asia also attracted native species. Trapping in a strawberry production area highlighted the possibility that S. latifascia and S. albula are potential pest species. Trials comparing different plastic-colored traps suggest that all white and green traps attracted fewer Spodoptera species moths than standard-colored Unitraps, which are green, yellow, and white.
Additional Links: PMID-41811978
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41811978,
year = {2026},
author = {Meagher, RL and Adamczyk, JJ and Renkema, J and Lance, D and Brambila, J},
title = {Cross attraction to various Spodoptera species using pheromone lures for native and exotic species.},
journal = {Environmental entomology},
volume = {55},
number = {2},
pages = {},
doi = {10.1093/ee/nvag006},
pmid = {41811978},
issn = {1938-2936},
support = {6615-22000-021-00D//U. S. Department of Agriculture CRIS/ ; 6036-22000-030-00//U. S. Department of Agriculture CRIS/ ; },
mesh = {Animals ; *Spodoptera/drug effects/physiology ; *Pheromones/pharmacology ; *Insect Control/methods ; Introduced Species ; Species Specificity ; Florida ; Texas ; Female ; Male ; },
abstract = {Previous research showed that the pheromone lure commercially formulated and produced for the exotic species Spodoptera exempta (Walker) also captured 2 native species, Spodoptera albula (Walker) and Spodoptera latifascia (Walker). This study expanded that work to identify the Spodoptera species that were attracted to lures specifically formulated for S. albula, Spodoptera cosmioides (Walker), Spodoptera eridania (Stoll in Cramer), Spodoptera exempta (Walker), Spodoptera exigua (Hübner), Spodoptera frugiperda (J. E. Smith), S. latifascia, Spodoptera litura (F.), and Spodoptera mauritia (Boisduval). In all trapping sites in Texas and Florida, S. exempta lures attracted S. latifascia and S. albula moths, sometimes at densities of over 80 moths per night. These lures, along with those designed for S. latifascia and S. albula, provided seasonal information for other Spodoptera species that are not routinely monitored. Lures for the South American species S. cosmioides consistently attracted the native non-pest Spodoptera dolichos (F.). Lures formulated for Spodoptera littoralis (Boisduval) from the Old World and S. litura from Asia also attracted native species. Trapping in a strawberry production area highlighted the possibility that S. latifascia and S. albula are potential pest species. Trials comparing different plastic-colored traps suggest that all white and green traps attracted fewer Spodoptera species moths than standard-colored Unitraps, which are green, yellow, and white.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Spodoptera/drug effects/physiology
*Pheromones/pharmacology
*Insect Control/methods
Introduced Species
Species Specificity
Florida
Texas
Female
Male
RevDate: 2026-03-12
CmpDate: 2026-03-12
Cordgrass invasion amplifies microplastic hazard through polymer-selective retention in coastal wetlands.
Water research, 296:125667.
Coastal wetlands are key repositories and pathways for microplastics (MPs), a role modulated by vegetation. The global spread of the nonnative cordgrass Spartina alterniflora is thus likely to alter MP deposition and fate, yet its effects on MP accumulation and related ecological risks are not well quantified. Integrating field surveys along an 18,000-km latitudinal transect (∼20°) of China's coastline with an ensemble of three machine-learning models, we produced a 500 m-resolution map of the MP polymer hazard index (PHI) in sediments (0-40 cm depth) and compared MP stocks and risks among native marshes, S. alterniflora-invaded marshes, and unvegetated mudflats. While MP abundance did not differ significantly between native and invaded marshes, PHI in invaded marshes was 20.0 % higher than in native marshes and 57.1 % higher than in mudflats, indicating a shift toward more hazardous polymers. This shift led to a marked expansion of high-risk coverage (increasing by 26.8 % compared with native marshes and 386.1 % relative to mudflats). Climatic variables (mean annual temperature and precipitation) emerged as dominant predictors of PHI across habitats, while plant invasion further accentuated habitat-specific effects mediated via microbial mediation. These results demonstrate that plant invasion amplifies coastal plastic pollution risk through both enhanced retention and selective accumulation of more hazardous polymers, underscoring the need to incorporate invasion control into coastal MP management strategies.
Additional Links: PMID-41780452
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41780452,
year = {2026},
author = {Su, F and He, X and Jin, Z and Xiao, K and Tian, P and Xiao, D},
title = {Cordgrass invasion amplifies microplastic hazard through polymer-selective retention in coastal wetlands.},
journal = {Water research},
volume = {296},
number = {},
pages = {125667},
doi = {10.1016/j.watres.2026.125667},
pmid = {41780452},
issn = {1879-2448},
mesh = {*Wetlands ; *Microplastics ; *Poaceae ; Introduced Species ; Water Pollutants, Chemical ; China ; Polymers ; Environmental Monitoring ; Geologic Sediments ; Seashore ; },
abstract = {Coastal wetlands are key repositories and pathways for microplastics (MPs), a role modulated by vegetation. The global spread of the nonnative cordgrass Spartina alterniflora is thus likely to alter MP deposition and fate, yet its effects on MP accumulation and related ecological risks are not well quantified. Integrating field surveys along an 18,000-km latitudinal transect (∼20°) of China's coastline with an ensemble of three machine-learning models, we produced a 500 m-resolution map of the MP polymer hazard index (PHI) in sediments (0-40 cm depth) and compared MP stocks and risks among native marshes, S. alterniflora-invaded marshes, and unvegetated mudflats. While MP abundance did not differ significantly between native and invaded marshes, PHI in invaded marshes was 20.0 % higher than in native marshes and 57.1 % higher than in mudflats, indicating a shift toward more hazardous polymers. This shift led to a marked expansion of high-risk coverage (increasing by 26.8 % compared with native marshes and 386.1 % relative to mudflats). Climatic variables (mean annual temperature and precipitation) emerged as dominant predictors of PHI across habitats, while plant invasion further accentuated habitat-specific effects mediated via microbial mediation. These results demonstrate that plant invasion amplifies coastal plastic pollution risk through both enhanced retention and selective accumulation of more hazardous polymers, underscoring the need to incorporate invasion control into coastal MP management strategies.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Wetlands
*Microplastics
*Poaceae
Introduced Species
Water Pollutants, Chemical
China
Polymers
Environmental Monitoring
Geologic Sediments
Seashore
RevDate: 2026-03-11
Role of Gut Bacteria in Tomato Leaf Miner Tuta absoluta Gaining Resistance to α-Tomatine by Converting It to Cholesterol.
Journal of agricultural and food chemistry [Epub ahead of print].
Tuta absoluta is a worldwide invasive pest that causes severe losses in tomato industry in China, while its resistance mechanism to tomato's protective alkaloid of α-tomatine remains unclear. This study explores the role of its gut microbiota, and results showed that the abundance of the gut symbiont Enterococcus mundtii was significantly higher in T. absoluta feeding on wild-type tomatoes than that in those feeding on α-tomatine-deficient GAME2 mutant tomatoes. Isolated E. mundtii strain E14 degraded 72.2 ± 1.3% of α-tomatine in vitro; reinoculating it into antibiotic-treated T. absoluta restored the degradation ability. Inoculating E14 into five other lepidopteran pests (except noncolonized Plutella xylostella) enhanced their α-tomatine tolerance. Multiomics and in vitro pure-culture experiments showed that α-tomatine degrades into cholesterol via deglycosylation, reduction, and hydrolysis. This study reveals α-tomatine's dual role (toxin/cholesterol precursor) and E. mundtii as a key adaptation mediator, advancing our understanding of insect-plant coevolution and invasive pest control.
Additional Links: PMID-41808257
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41808257,
year = {2026},
author = {Chen, Y and Chen, Y and Du, E and Chen, X and Liu, W and Li, Y and Zeng, N and Zi, X and He, Q and Li, Z and Su, R and Gui, F},
title = {Role of Gut Bacteria in Tomato Leaf Miner Tuta absoluta Gaining Resistance to α-Tomatine by Converting It to Cholesterol.},
journal = {Journal of agricultural and food chemistry},
volume = {},
number = {},
pages = {},
doi = {10.1021/acs.jafc.5c16815},
pmid = {41808257},
issn = {1520-5118},
abstract = {Tuta absoluta is a worldwide invasive pest that causes severe losses in tomato industry in China, while its resistance mechanism to tomato's protective alkaloid of α-tomatine remains unclear. This study explores the role of its gut microbiota, and results showed that the abundance of the gut symbiont Enterococcus mundtii was significantly higher in T. absoluta feeding on wild-type tomatoes than that in those feeding on α-tomatine-deficient GAME2 mutant tomatoes. Isolated E. mundtii strain E14 degraded 72.2 ± 1.3% of α-tomatine in vitro; reinoculating it into antibiotic-treated T. absoluta restored the degradation ability. Inoculating E14 into five other lepidopteran pests (except noncolonized Plutella xylostella) enhanced their α-tomatine tolerance. Multiomics and in vitro pure-culture experiments showed that α-tomatine degrades into cholesterol via deglycosylation, reduction, and hydrolysis. This study reveals α-tomatine's dual role (toxin/cholesterol precursor) and E. mundtii as a key adaptation mediator, advancing our understanding of insect-plant coevolution and invasive pest control.},
}
RevDate: 2026-03-10
CmpDate: 2026-03-11
Expanding invasive species impact assessments to the ecosystem level with EEICAT.
PLoS biology, 24(3):e3003665.
The ecological impacts of biological invasions vary widely in type, scale, and severity, highlighting the need for consistent assessment tools. The Environmental Impact Classification for Alien Taxa (EICAT) provides a standardized framework for assessing their effects, but focuses mainly on population-level impacts. We introduce the Extended EICAT (EEICAT), which incorporates impacts across three ecological dimensions, from individuals to ecosystems, with an impact-based approach. EEICAT enables classification of 19 impact types at the invasion-event level, making it suitable for primary research, synthesis, and management. This framework aims to improve the detection, comparison, and communication of complex ecological impacts caused by biological invasions.
Additional Links: PMID-41805746
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41805746,
year = {2026},
author = {Carneiro, L and Pincheira-Donoso, D and Leroy, B and Bertolino, S and Camacho-Cervantes, M and Cuthbert, RN and Bang, A and Catford, JA and South, J and Cooke, SJ and Angulo, E and Courchamp, F},
title = {Expanding invasive species impact assessments to the ecosystem level with EEICAT.},
journal = {PLoS biology},
volume = {24},
number = {3},
pages = {e3003665},
pmid = {41805746},
issn = {1545-7885},
mesh = {*Introduced Species ; *Ecosystem ; Animals ; },
abstract = {The ecological impacts of biological invasions vary widely in type, scale, and severity, highlighting the need for consistent assessment tools. The Environmental Impact Classification for Alien Taxa (EICAT) provides a standardized framework for assessing their effects, but focuses mainly on population-level impacts. We introduce the Extended EICAT (EEICAT), which incorporates impacts across three ecological dimensions, from individuals to ecosystems, with an impact-based approach. EEICAT enables classification of 19 impact types at the invasion-event level, making it suitable for primary research, synthesis, and management. This framework aims to improve the detection, comparison, and communication of complex ecological impacts caused by biological invasions.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Introduced Species
*Ecosystem
Animals
RevDate: 2026-03-11
CmpDate: 2026-03-11
Behavior-based stratified management: population suppression and invasion front control of Hylurgus ligniperda (Fabricius) in coastal shelterbelt ecosystems.
Pest management science, 82(4):3384-3394.
BACKGROUND: The red-haired bark beetle (RHB), Hylurgus ligniperda (Fabricius), is a significant invasive pest responsible for widespread mortality in pine forests. Current control methods are largely ineffective and poorly integrated, failing to halt the spread of RHB. This study aimed to develop and validate an integrated management system that leverages the beetle's behavioral patterns and implements stratified management strategies based on the severity of infestation levels.
RESULTS: We first enhanced trapping efficiency by optimizing key technologies, including trap design, deployment methods, and lure formulations. Building on this foundation, we developed a stratified management plan with the following key measures: in newly colonized stands, a strategy combining benzyl alcohol repellents and optimized lure attractants, along with flight-interception traps, significantly reduced spread, decreasing the proportion of dead trees from 12.5% to 2.6%. In outbreak stands, intensive measures such as stump removal and mass trapping reduced the RHB population density by 99.05%. Additionally, replanting alters stand volatiles, reducing their attractiveness to the beetles.
CONCLUSION: The stratified management strategy, applied to both newly colonized and outbreak stands of RHB, proved highly effective in suppressing population growth and preventing further dispersal. This approach offers a key technical solution for restoring damaged coastal ecosystems and provides a valuable reference for managing similar invasive pests worldwide. © 2025 Society of Chemical Industry.
Additional Links: PMID-41410089
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41410089,
year = {2026},
author = {Chen, H and Xie, D and Pan, Z and Jia, N and Zhou, J and Yang, Q and Yu, J and Chi, D},
title = {Behavior-based stratified management: population suppression and invasion front control of Hylurgus ligniperda (Fabricius) in coastal shelterbelt ecosystems.},
journal = {Pest management science},
volume = {82},
number = {4},
pages = {3384-3394},
doi = {10.1002/ps.70465},
pmid = {41410089},
issn = {1526-4998},
support = {//National Key Research and Development Program of China (2021YFD1400300)/ ; },
mesh = {Animals ; *Insect Control/methods ; *Introduced Species ; Pinus/growth & development ; *Weevils/physiology ; Ecosystem ; *Coleoptera/physiology ; Behavior, Animal ; },
abstract = {BACKGROUND: The red-haired bark beetle (RHB), Hylurgus ligniperda (Fabricius), is a significant invasive pest responsible for widespread mortality in pine forests. Current control methods are largely ineffective and poorly integrated, failing to halt the spread of RHB. This study aimed to develop and validate an integrated management system that leverages the beetle's behavioral patterns and implements stratified management strategies based on the severity of infestation levels.
RESULTS: We first enhanced trapping efficiency by optimizing key technologies, including trap design, deployment methods, and lure formulations. Building on this foundation, we developed a stratified management plan with the following key measures: in newly colonized stands, a strategy combining benzyl alcohol repellents and optimized lure attractants, along with flight-interception traps, significantly reduced spread, decreasing the proportion of dead trees from 12.5% to 2.6%. In outbreak stands, intensive measures such as stump removal and mass trapping reduced the RHB population density by 99.05%. Additionally, replanting alters stand volatiles, reducing their attractiveness to the beetles.
CONCLUSION: The stratified management strategy, applied to both newly colonized and outbreak stands of RHB, proved highly effective in suppressing population growth and preventing further dispersal. This approach offers a key technical solution for restoring damaged coastal ecosystems and provides a valuable reference for managing similar invasive pests worldwide. © 2025 Society of Chemical Industry.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Insect Control/methods
*Introduced Species
Pinus/growth & development
*Weevils/physiology
Ecosystem
*Coleoptera/physiology
Behavior, Animal
RevDate: 2026-03-11
CmpDate: 2026-03-11
Invasive alien plant biomass-derived hard carbon anode for sodium-ion batteries.
Chemosphere, 343:140220.
In the context of rampant growth of invasive plants, finding suitable ways for resource utilization has become the optimal choice for invasive plant management. In the field of energy storage, sodium-ion batteries have been limited by the lack of appropriate anode materials, and hard carbon stands out as the most promising candidate. Therefore, this study focuses on the preparation of biomass-derived carbons from three invasive plant species, namely Spartina alterniflora Loisel., Solidago canadensis L., and Erigeron canadensis L., through high-temperature carbonization. The resulting biomass carbons are then subjected to cleaning and activation processes to prepare sodium-ion anode materials. The internal structure of the materials was characterized using SEM, TEM, XRD, XPS, Raman spectroscopy, and BET. The materials exhibited a significant amount of pore structures, with interlayer spacing around 0.37 nm, which is larger than the original graphite interlayer spacing. The plant anode materials were assembled into full batteries for cyclic charge/discharge tests. The results show that all three anode materials have good multiplicative performance and excellent cyclable charge/discharge. After 100 cycles at a current of 50 mA in the voltage range of 0-3.0 V, the reversible capacities of the three materials reached 245.3, 207.19, and 227.12 mAh/g, respectively. Among them, the material derived from Spartina alterniflora maintained a capacity of 141.63 mAh/g even after 1000 cycles at a current of 200 mA, demonstrating the best capacity performance.
Additional Links: PMID-37739130
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid37739130,
year = {2023},
author = {Wei, H and Cheng, H and Yao, N and Li, G and Du, Z and Luo, R and Zheng, Z},
title = {Invasive alien plant biomass-derived hard carbon anode for sodium-ion batteries.},
journal = {Chemosphere},
volume = {343},
number = {},
pages = {140220},
doi = {10.1016/j.chemosphere.2023.140220},
pmid = {37739130},
issn = {1879-1298},
mesh = {Biomass ; Electrodes ; *Carbon/chemistry ; *Electric Power Supplies ; *Sodium/chemistry ; *Introduced Species ; },
abstract = {In the context of rampant growth of invasive plants, finding suitable ways for resource utilization has become the optimal choice for invasive plant management. In the field of energy storage, sodium-ion batteries have been limited by the lack of appropriate anode materials, and hard carbon stands out as the most promising candidate. Therefore, this study focuses on the preparation of biomass-derived carbons from three invasive plant species, namely Spartina alterniflora Loisel., Solidago canadensis L., and Erigeron canadensis L., through high-temperature carbonization. The resulting biomass carbons are then subjected to cleaning and activation processes to prepare sodium-ion anode materials. The internal structure of the materials was characterized using SEM, TEM, XRD, XPS, Raman spectroscopy, and BET. The materials exhibited a significant amount of pore structures, with interlayer spacing around 0.37 nm, which is larger than the original graphite interlayer spacing. The plant anode materials were assembled into full batteries for cyclic charge/discharge tests. The results show that all three anode materials have good multiplicative performance and excellent cyclable charge/discharge. After 100 cycles at a current of 50 mA in the voltage range of 0-3.0 V, the reversible capacities of the three materials reached 245.3, 207.19, and 227.12 mAh/g, respectively. Among them, the material derived from Spartina alterniflora maintained a capacity of 141.63 mAh/g even after 1000 cycles at a current of 200 mA, demonstrating the best capacity performance.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Biomass
Electrodes
*Carbon/chemistry
*Electric Power Supplies
*Sodium/chemistry
*Introduced Species
RevDate: 2026-03-11
CmpDate: 2026-03-11
Experimental heatwaves facilitate invasion and alter species interactions and composition in a tropical host-parasitoid community.
Global change biology, 29(22):6261-6275.
As mean temperatures increase and heatwaves become more frequent, species are expanding their distributions to colonise new habitats. The resulting novel species interactions will simultaneously shape the temperature-driven reorganization of resident communities. The interactive effects of climate change and climate change-facilitated invasion have rarely been studied in multi-trophic communities, and are likely to differ depending on the nature of the climatic driver (i.e., climate extremes or constant warming). We re-created under laboratory conditions a host-parasitoid community typical of high-elevation rainforest sites in Queensland, Australia, comprising four Drosophila species and two associated parasitoid species. We subjected these communities to an equivalent increase in average temperature in the form of periodic heatwaves or constant warming, in combination with an invasion treatment involving a novel host species from lower-elevation habitats. The two parasitoid species were sensitive to both warming and heatwaves, while the demographic responses of Drosophila species were highly idiosyncratic, reflecting the combined effects of thermal tolerance, parasitism, competition, and facilitation. After multiple generations, our heatwave treatment promoted the establishment of low-elevation species in upland communities. Invasion of the low-elevation species correlated negatively with the abundance of one of the parasitoid species, leading to cascading effects on its hosts and their competitors. Our study, therefore, reveals differing, sometimes contrasting, impacts of extreme temperatures and constant warming on community composition. It also highlights how the scale and direction of climate impacts could be further modified by invading species within a bi-trophic community network.
Additional Links: PMID-37733768
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid37733768,
year = {2023},
author = {Chen, J and Lewis, OT},
title = {Experimental heatwaves facilitate invasion and alter species interactions and composition in a tropical host-parasitoid community.},
journal = {Global change biology},
volume = {29},
number = {22},
pages = {6261-6275},
doi = {10.1111/gcb.16937},
pmid = {37733768},
issn = {1365-2486},
support = {201806010328//China Scholarship Council/ ; NE/N010221/1//Natural Environment Research Council/ ; },
mesh = {Animals ; *Introduced Species ; *Host-Parasite Interactions ; *Drosophila/physiology/parasitology ; Queensland ; *Climate Change ; *Hot Temperature ; Tropical Climate ; Ecosystem ; *Wasps/physiology ; },
abstract = {As mean temperatures increase and heatwaves become more frequent, species are expanding their distributions to colonise new habitats. The resulting novel species interactions will simultaneously shape the temperature-driven reorganization of resident communities. The interactive effects of climate change and climate change-facilitated invasion have rarely been studied in multi-trophic communities, and are likely to differ depending on the nature of the climatic driver (i.e., climate extremes or constant warming). We re-created under laboratory conditions a host-parasitoid community typical of high-elevation rainforest sites in Queensland, Australia, comprising four Drosophila species and two associated parasitoid species. We subjected these communities to an equivalent increase in average temperature in the form of periodic heatwaves or constant warming, in combination with an invasion treatment involving a novel host species from lower-elevation habitats. The two parasitoid species were sensitive to both warming and heatwaves, while the demographic responses of Drosophila species were highly idiosyncratic, reflecting the combined effects of thermal tolerance, parasitism, competition, and facilitation. After multiple generations, our heatwave treatment promoted the establishment of low-elevation species in upland communities. Invasion of the low-elevation species correlated negatively with the abundance of one of the parasitoid species, leading to cascading effects on its hosts and their competitors. Our study, therefore, reveals differing, sometimes contrasting, impacts of extreme temperatures and constant warming on community composition. It also highlights how the scale and direction of climate impacts could be further modified by invading species within a bi-trophic community network.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Introduced Species
*Host-Parasite Interactions
*Drosophila/physiology/parasitology
Queensland
*Climate Change
*Hot Temperature
Tropical Climate
Ecosystem
*Wasps/physiology
RevDate: 2026-03-11
CmpDate: 2026-03-11
Global genomic signature reveals the evolution of fall armyworm in the Eastern hemisphere.
Molecular ecology, 32(20):5463-5478.
The major plant pest fall armyworm (FAW), Spodoptera frugiperda, is native to the Americas and has colonized Africa and Asia within the Eastern hemisphere since 2016, causing severe damage to multiple agricultural crop species. However, the genetic origin of these invasive populations requires more in-depth exploration. We analysed genetic variation across the genomes of 280 FAW individuals from both the Eastern hemisphere and the Americas. The global range-wide genetic structure of FAW shows that the FAW in America has experienced deep differentiation, largely consistent with the Z-chromosomal Tpi haplotypes commonly used to differentiate 'corn-strain' and 'rice-strain' populations. The invasive populations from Africa and Asia are different from the American ones and have a relatively homogeneous population structure, consistent with the common origin and recent spreading from Africa to Asia. Our analyses suggest that north- and central American 'corn-strain' FAW are the most likely sources of the invasion into the Eastern hemisphere. Furthermore, evidence based on genomic, transcriptomic and mitochondrial haplotype network analyses indicates an earlier, independent introduction of FAW into Africa, with subsequent migration into the recent invasive population.
Additional Links: PMID-37638537
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid37638537,
year = {2023},
author = {Zhang, L and Li, Z and Peng, Y and Liang, X and Wilson, K and Chipabika, G and Karangwa, P and Uzayisenga, B and Mensah, BA and Kachigamba, DL and Xiao, Y},
title = {Global genomic signature reveals the evolution of fall armyworm in the Eastern hemisphere.},
journal = {Molecular ecology},
volume = {32},
number = {20},
pages = {5463-5478},
doi = {10.1111/mec.17117},
pmid = {37638537},
issn = {1365-294X},
support = {JCYJ20200109150629266//Shenzhen Natural Science Foundation/ ; NIF\R1\191106//The Newton International Fellowship/ ; 2022ZD04021//STI 2030-Major Projects/ ; BB/P023444/1andEP/T024410/1//Global Challenges Research Fund/ ; },
mesh = {Animals ; Haplotypes ; *Spodoptera/genetics ; *Genetics, Population ; Genetic Variation ; *Genome, Insect ; Africa ; Genomics ; Asia ; Introduced Species ; Americas ; *Biological Evolution ; },
abstract = {The major plant pest fall armyworm (FAW), Spodoptera frugiperda, is native to the Americas and has colonized Africa and Asia within the Eastern hemisphere since 2016, causing severe damage to multiple agricultural crop species. However, the genetic origin of these invasive populations requires more in-depth exploration. We analysed genetic variation across the genomes of 280 FAW individuals from both the Eastern hemisphere and the Americas. The global range-wide genetic structure of FAW shows that the FAW in America has experienced deep differentiation, largely consistent with the Z-chromosomal Tpi haplotypes commonly used to differentiate 'corn-strain' and 'rice-strain' populations. The invasive populations from Africa and Asia are different from the American ones and have a relatively homogeneous population structure, consistent with the common origin and recent spreading from Africa to Asia. Our analyses suggest that north- and central American 'corn-strain' FAW are the most likely sources of the invasion into the Eastern hemisphere. Furthermore, evidence based on genomic, transcriptomic and mitochondrial haplotype network analyses indicates an earlier, independent introduction of FAW into Africa, with subsequent migration into the recent invasive population.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
Haplotypes
*Spodoptera/genetics
*Genetics, Population
Genetic Variation
*Genome, Insect
Africa
Genomics
Asia
Introduced Species
Americas
*Biological Evolution
RevDate: 2026-03-11
CmpDate: 2026-03-11
A plague of weasels and ticks: animal introduction, ecological disaster, and the balance of nature in Jamaica, 1870-1900.
British journal for the history of science, 56(3):391-407.
Towards the end of the nineteenth century, British colonists in Jamaica became increasingly exasperated by the damage caused to their sugar plantations by rats. In 1872, a British planter attempted to solve this problem by introducing the small Indian mongoose (Urva auropunctata). The animals, however, turned on Jamaica's insectivorous birds and reptiles, leading to an explosion in the tick population. This paper situates the mongoose catastrophe as a closing chapter in the history of the nineteenth-century acclimatization movement. While foreign observers saw the introduction of the mongoose as a cautionary tale, caricaturing British Jamaica as overrun by a plague of weasels and ticks, British colonists, administrators and naturalists - identifying a gradual decline of both populations - argued that the 'balance of nature' would eventually reassert itself. As this paper argues, through this dubious claim they were attempting to retrospectively rationalize or justify the introductions and their disastrous aftermath. This strategy enabled them to gloss over the lasting ecological damage caused by the mongoose, and allowed its adherents to continue their uncritical support of both the Jamaican plantation economy and animal introductions in the British Empire.
Additional Links: PMID-37608763
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid37608763,
year = {2023},
author = {Holmes, M},
title = {A plague of weasels and ticks: animal introduction, ecological disaster, and the balance of nature in Jamaica, 1870-1900.},
journal = {British journal for the history of science},
volume = {56},
number = {3},
pages = {391-407},
doi = {10.1017/S0007087423000286},
pmid = {37608763},
issn = {1474-001X},
mesh = {Animals ; History, 19th Century ; Jamaica ; *Herpestidae ; *Introduced Species/history ; *Ticks ; Colonialism/history ; },
abstract = {Towards the end of the nineteenth century, British colonists in Jamaica became increasingly exasperated by the damage caused to their sugar plantations by rats. In 1872, a British planter attempted to solve this problem by introducing the small Indian mongoose (Urva auropunctata). The animals, however, turned on Jamaica's insectivorous birds and reptiles, leading to an explosion in the tick population. This paper situates the mongoose catastrophe as a closing chapter in the history of the nineteenth-century acclimatization movement. While foreign observers saw the introduction of the mongoose as a cautionary tale, caricaturing British Jamaica as overrun by a plague of weasels and ticks, British colonists, administrators and naturalists - identifying a gradual decline of both populations - argued that the 'balance of nature' would eventually reassert itself. As this paper argues, through this dubious claim they were attempting to retrospectively rationalize or justify the introductions and their disastrous aftermath. This strategy enabled them to gloss over the lasting ecological damage caused by the mongoose, and allowed its adherents to continue their uncritical support of both the Jamaican plantation economy and animal introductions in the British Empire.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
History, 19th Century
Jamaica
*Herpestidae
*Introduced Species/history
*Ticks
Colonialism/history
RevDate: 2026-03-11
CmpDate: 2026-03-11
Plant invasion and fragmentation indirectly and contrastingly affect native plants and grassland arthropods.
The Science of the total environment, 903:166199.
Plant invasion and habitat fragmentation have a detrimental effect on biodiversity in nearly all types of ecosystems. We compared the direct and indirect effects of the invasion of the common milkweed (Asclepias syriaca) on biodiversity patterns in different-sized Hungarian forest-steppe fragments. We assessed vegetation structure, measured temperature and soil moisture, and studied organisms with different ecological roles in invaded and non-invaded sites of fragments: plants, bees, butterflies, flower-visiting wasps, flies, true bugs, and spiders. Temperature and soil moisture were lower in invaded than in non-invaded area. Milkweed had a positive effect on plant species richness and flower abundance. In contrast, we mainly found indirect effects of invasion on arthropods through alteration of physical habitat characteristics and food resources. Pollinators were positively affected by native flowers, thus, milkweed indirectly supported pollinators. Similarly, we found higher species richness of herbivores in invaded sites than control sites, as species richness of true bugs also increased with increasing plant species richness. Predators were positively affected by complex vegetation structure, higher soil moisture and lower temperature. Furthermore, increasing fragment size had a strong negative effect on spider species richness of non-invaded sites, but no effect in invaded sites. Especially, grassland specialist spiders were more sensitive to fragment size than generalists, whereas generalist spider species rather profited from invasion. Although milkweed invades natural areas, we did not identify strong negative effects of its presence on the diversity of the grassland biota. However, the supportive effect of milkweed on a few generalist species homogenises the communities. The rate of invasion might increase with increasing fragmentation, therefore we recommend eliminating invasive plants from small habitat fragments to preserve the native biota. Focusing also on generalist species and revealing the indirect effects of invasions are essential for understanding the invasion mechanisms and would support restoration efforts.
Additional Links: PMID-37572908
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid37572908,
year = {2023},
author = {Gallé, R and Tölgyesi, C and Szabó, ÁR and Korányi, D and Bátori, Z and Hábenczyus, A and Török, E and Révész, K and Torma, A and Gallé-Szpisjak, N and Lakatos, T and Batáry, P},
title = {Plant invasion and fragmentation indirectly and contrastingly affect native plants and grassland arthropods.},
journal = {The Science of the total environment},
volume = {903},
number = {},
pages = {166199},
doi = {10.1016/j.scitotenv.2023.166199},
pmid = {37572908},
issn = {1879-1026},
mesh = {*Introduced Species ; *Grassland ; *Biodiversity ; Animals ; *Arthropods/physiology ; *Asclepias/physiology ; Ecosystem ; Hungary ; },
abstract = {Plant invasion and habitat fragmentation have a detrimental effect on biodiversity in nearly all types of ecosystems. We compared the direct and indirect effects of the invasion of the common milkweed (Asclepias syriaca) on biodiversity patterns in different-sized Hungarian forest-steppe fragments. We assessed vegetation structure, measured temperature and soil moisture, and studied organisms with different ecological roles in invaded and non-invaded sites of fragments: plants, bees, butterflies, flower-visiting wasps, flies, true bugs, and spiders. Temperature and soil moisture were lower in invaded than in non-invaded area. Milkweed had a positive effect on plant species richness and flower abundance. In contrast, we mainly found indirect effects of invasion on arthropods through alteration of physical habitat characteristics and food resources. Pollinators were positively affected by native flowers, thus, milkweed indirectly supported pollinators. Similarly, we found higher species richness of herbivores in invaded sites than control sites, as species richness of true bugs also increased with increasing plant species richness. Predators were positively affected by complex vegetation structure, higher soil moisture and lower temperature. Furthermore, increasing fragment size had a strong negative effect on spider species richness of non-invaded sites, but no effect in invaded sites. Especially, grassland specialist spiders were more sensitive to fragment size than generalists, whereas generalist spider species rather profited from invasion. Although milkweed invades natural areas, we did not identify strong negative effects of its presence on the diversity of the grassland biota. However, the supportive effect of milkweed on a few generalist species homogenises the communities. The rate of invasion might increase with increasing fragmentation, therefore we recommend eliminating invasive plants from small habitat fragments to preserve the native biota. Focusing also on generalist species and revealing the indirect effects of invasions are essential for understanding the invasion mechanisms and would support restoration efforts.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Introduced Species
*Grassland
*Biodiversity
Animals
*Arthropods/physiology
*Asclepias/physiology
Ecosystem
Hungary
RevDate: 2026-03-11
CmpDate: 2026-03-11
Behavior of higher trophic levels associated with an invasive plant varies among populations.
Environmental entomology, 52(5):870-878.
Invasive plants from their native and introduced ranges differ in their interactions with herbivores but it is not known whether they also vary in their interactions with herbivore natural enemies. Here, we used olfactometer bioassays and cage experiments to investigate how foraging behaviors of 2 parasitoid and 1 hyperparasitoid species depended on plant population origin. Triadica sebifera (Euphorbiaceae) is native to China but invasive in the United States. In China, it is fed on by a specialist noctuid Gadirtha fusca (Lepidoptera: Nolidae), which hosts a parasitoid Apanteles sp. (Hymenoptera: Microgastinae) and hyperparasitoid (Hymenoptera: Eurytomidae) plus a generalist aphid Toxoptera odinae (Homoptera: Aphidiidae) parasitized by Lysiphlebus confusus (Hymenoptera: Aphidiinae). Both parasitoids preferred plants infested by their host over herbivore-free plants in olfactometer bioassays. Apanteles sp. and Eurytomid wasps preferred G. fusca infested plants from China populations over those from US populations in olfactometer bioassays but L. confusus wasps did not discriminate between T. odinae infested plants from China vs. US populations. Similarly, G. fusca caterpillars on China population plants were more likely to be parasitized than ones on US population plants when they were in the same cage but odds of parasitism for T. odinae did not differ for those on China vs. US population plants. These results suggest that populations from the native and introduced ranges may differ in traits that impact higher trophic levels. This may have implications for successful control of invasive plants as biocontrol agents are introduced or herbivores begin to feed on them in their introduced ranges.
Additional Links: PMID-37530696
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid37530696,
year = {2023},
author = {Ismail, M and Siemann, E and Ding, J},
title = {Behavior of higher trophic levels associated with an invasive plant varies among populations.},
journal = {Environmental entomology},
volume = {52},
number = {5},
pages = {870-878},
doi = {10.1093/ee/nvad067},
pmid = {37530696},
issn = {1938-2936},
support = {2016PB030//China National R&D Program/ ; 31370404//National Natural Science Foundation of China/ ; },
mesh = {Animals ; *Introduced Species ; *Wasps/physiology ; *Moths/parasitology/physiology/growth & development ; China ; *Food Chain ; *Euphorbiaceae/physiology ; *Aphids/physiology/parasitology ; Host-Parasite Interactions ; Herbivory ; Female ; Larva/growth & development/physiology/parasitology ; },
abstract = {Invasive plants from their native and introduced ranges differ in their interactions with herbivores but it is not known whether they also vary in their interactions with herbivore natural enemies. Here, we used olfactometer bioassays and cage experiments to investigate how foraging behaviors of 2 parasitoid and 1 hyperparasitoid species depended on plant population origin. Triadica sebifera (Euphorbiaceae) is native to China but invasive in the United States. In China, it is fed on by a specialist noctuid Gadirtha fusca (Lepidoptera: Nolidae), which hosts a parasitoid Apanteles sp. (Hymenoptera: Microgastinae) and hyperparasitoid (Hymenoptera: Eurytomidae) plus a generalist aphid Toxoptera odinae (Homoptera: Aphidiidae) parasitized by Lysiphlebus confusus (Hymenoptera: Aphidiinae). Both parasitoids preferred plants infested by their host over herbivore-free plants in olfactometer bioassays. Apanteles sp. and Eurytomid wasps preferred G. fusca infested plants from China populations over those from US populations in olfactometer bioassays but L. confusus wasps did not discriminate between T. odinae infested plants from China vs. US populations. Similarly, G. fusca caterpillars on China population plants were more likely to be parasitized than ones on US population plants when they were in the same cage but odds of parasitism for T. odinae did not differ for those on China vs. US population plants. These results suggest that populations from the native and introduced ranges may differ in traits that impact higher trophic levels. This may have implications for successful control of invasive plants as biocontrol agents are introduced or herbivores begin to feed on them in their introduced ranges.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Introduced Species
*Wasps/physiology
*Moths/parasitology/physiology/growth & development
China
*Food Chain
*Euphorbiaceae/physiology
*Aphids/physiology/parasitology
Host-Parasite Interactions
Herbivory
Female
Larva/growth & development/physiology/parasitology
RevDate: 2026-03-11
CmpDate: 2026-03-11
Assessment of spilled toxic bait by wild pigs and potential risk to non-target species.
Pest management science, 79(11):4589-4598.
BACKGROUND: In 2018, a sodium nitrite (SN)-based toxic bait for invasive wild pigs (hereafter wild pigs; Sus scrofa), was evaluated to determine its effectiveness in reducing local wild pig populations in Texas. Localized population reductions of >70% were achieved, but spillage of bait outside wild pig-specific feeders (bait stations) caused by feeding wild pigs resulted in the deaths of non-target animals. To evaluate risks to non-target animals, we tested whether bait presentation influenced the total amount of bait spilled by wild pigs and estimated the associated risk to non-target species.
RESULTS: We found that bait spilled outside bait stations could be reduced by >90% when compacted in trays, as opposed to being manually crumbled into pieces. We documented a mean spill rate of 0.913 g of bait per wild pig. Conservative risk assessments for nine non-target species for which SN toxicity data exist indicate that there is relatively low risk of lethal exposure, apart from zebra finches (Taeniopygia guttata) and white mice. Our results indicate that there may be enough spilled bait per feeding wild pig to kill 9.5 or 3.5 individuals of these species, respectively. Other species assessed range from 0.002 to 0.406 potential mortalities per wild pig.
CONCLUSION: We demonstrated that the amount of bait spilled by wild pigs during feeding and the associated risk to non-target animals can be minimized by presenting the bait compacted in trays within bait stations. We recommend that baits be tightly compacted and secured in bait stations to minimize risks to non-target animals from spilled bait by wild pigs. © 2023 Society of Chemical Industry. This article has been contributed to by U.S. Government employees and their work is in the public domain in the USA.
Additional Links: PMID-37431651
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid37431651,
year = {2023},
author = {Kinsey, JC and Foster, JA and Snow, NP and Wishart, JD and Staples, LD and Bush, JK and VerCauteren, KC},
title = {Assessment of spilled toxic bait by wild pigs and potential risk to non-target species.},
journal = {Pest management science},
volume = {79},
number = {11},
pages = {4589-4598},
doi = {10.1002/ps.7658},
pmid = {37431651},
issn = {1526-4998},
support = {//Animal Control Technologies Australia/ ; //Texas Parks and Wildlife Department/ ; //U.S. Department of Agriculture/ ; },
mesh = {Animals ; *Sus scrofa ; *Sodium Nitrite/toxicity ; Texas ; Risk Assessment ; Introduced Species ; Animals, Wild ; Swine ; },
abstract = {BACKGROUND: In 2018, a sodium nitrite (SN)-based toxic bait for invasive wild pigs (hereafter wild pigs; Sus scrofa), was evaluated to determine its effectiveness in reducing local wild pig populations in Texas. Localized population reductions of >70% were achieved, but spillage of bait outside wild pig-specific feeders (bait stations) caused by feeding wild pigs resulted in the deaths of non-target animals. To evaluate risks to non-target animals, we tested whether bait presentation influenced the total amount of bait spilled by wild pigs and estimated the associated risk to non-target species.
RESULTS: We found that bait spilled outside bait stations could be reduced by >90% when compacted in trays, as opposed to being manually crumbled into pieces. We documented a mean spill rate of 0.913 g of bait per wild pig. Conservative risk assessments for nine non-target species for which SN toxicity data exist indicate that there is relatively low risk of lethal exposure, apart from zebra finches (Taeniopygia guttata) and white mice. Our results indicate that there may be enough spilled bait per feeding wild pig to kill 9.5 or 3.5 individuals of these species, respectively. Other species assessed range from 0.002 to 0.406 potential mortalities per wild pig.
CONCLUSION: We demonstrated that the amount of bait spilled by wild pigs during feeding and the associated risk to non-target animals can be minimized by presenting the bait compacted in trays within bait stations. We recommend that baits be tightly compacted and secured in bait stations to minimize risks to non-target animals from spilled bait by wild pigs. © 2023 Society of Chemical Industry. This article has been contributed to by U.S. Government employees and their work is in the public domain in the USA.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Sus scrofa
*Sodium Nitrite/toxicity
Texas
Risk Assessment
Introduced Species
Animals, Wild
Swine
RevDate: 2026-03-11
CmpDate: 2026-03-11
Ace and ace-like genes of invasive redlegged earth mite: copy number variation, target-site mutations, and their associations with organophosphate insensitivity.
Pest management science, 79(11):4219-4230.
BACKGROUND: Invasive Australian populations of redlegged earth mite, Halotydeus destructor (Tucker), are evolving increasing organophosphate resistance. In addition to the canonical ace gene, the target gene of organophosphates, the H. destructor genome contains many radiated ace-like genes that vary in copy number and amino acid sequence. In this work, we characterise copy number and target-site mutation variation at the canonical ace and ace-like genes and test for potential associations with organophosphate insensitivity. This was achieved through comparisons of whole-genome pool-seq data from alive and dead mites following organophosphate exposure.
RESULTS: A combination of increased copy number and target-site mutations at the canonical ace was associated with organophosphate insensitivity in H. destructor. Resistant populations were segregating for G119S, A201S, F331Y at the canonical ace. A subset of populations also had copy numbers of canonical ace > 2, which potentially helps overexpress proteins carrying these target-site mutations. Haplotypes possessing different copy numbers and target-site mutations of the canonical ace gene may be under selection across H. destructor populations. We also detected some evidence that increases in copy number of radiated ace-like genes are associated with organophosphate insensitivity, which might suggest potential roles in sequestration or breakdown of organophosphates.
CONCLUSION: Different combinations of target-site mutations and (or) copy number variation in the canonical ace and ace-like genes may provide non-convergent ways for H. destructor to respond to organophosphate selection. However, these changes may only play a partial role in organophosphate insensitivity, which appears to have a polygenic architecture. © 2023 The Authors. Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry.
Additional Links: PMID-37332098
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid37332098,
year = {2023},
author = {Thia, JA and Umina, PA and Hoffmann, AA},
title = {Ace and ace-like genes of invasive redlegged earth mite: copy number variation, target-site mutations, and their associations with organophosphate insensitivity.},
journal = {Pest management science},
volume = {79},
number = {11},
pages = {4219-4230},
doi = {10.1002/ps.7619},
pmid = {37332098},
issn = {1526-4998},
support = {//Grains Research and Development Corporation/ ; //University of Melbourne/ ; },
mesh = {Animals ; *DNA Copy Number Variations ; *Organophosphates/pharmacology ; Mutation ; *Mites/genetics/drug effects ; *Acaricides/pharmacology ; *Insecticide Resistance/genetics ; Introduced Species ; },
abstract = {BACKGROUND: Invasive Australian populations of redlegged earth mite, Halotydeus destructor (Tucker), are evolving increasing organophosphate resistance. In addition to the canonical ace gene, the target gene of organophosphates, the H. destructor genome contains many radiated ace-like genes that vary in copy number and amino acid sequence. In this work, we characterise copy number and target-site mutation variation at the canonical ace and ace-like genes and test for potential associations with organophosphate insensitivity. This was achieved through comparisons of whole-genome pool-seq data from alive and dead mites following organophosphate exposure.
RESULTS: A combination of increased copy number and target-site mutations at the canonical ace was associated with organophosphate insensitivity in H. destructor. Resistant populations were segregating for G119S, A201S, F331Y at the canonical ace. A subset of populations also had copy numbers of canonical ace > 2, which potentially helps overexpress proteins carrying these target-site mutations. Haplotypes possessing different copy numbers and target-site mutations of the canonical ace gene may be under selection across H. destructor populations. We also detected some evidence that increases in copy number of radiated ace-like genes are associated with organophosphate insensitivity, which might suggest potential roles in sequestration or breakdown of organophosphates.
CONCLUSION: Different combinations of target-site mutations and (or) copy number variation in the canonical ace and ace-like genes may provide non-convergent ways for H. destructor to respond to organophosphate selection. However, these changes may only play a partial role in organophosphate insensitivity, which appears to have a polygenic architecture. © 2023 The Authors. Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*DNA Copy Number Variations
*Organophosphates/pharmacology
Mutation
*Mites/genetics/drug effects
*Acaricides/pharmacology
*Insecticide Resistance/genetics
Introduced Species
RevDate: 2026-03-09
CmpDate: 2026-03-09
Identification and characterization of a wet adhesive protein extracted from Dreissena bugensis, the freshwater quagga mussel.
Proceedings of the National Academy of Sciences of the United States of America, 123(11):e2537453123.
Mechanisms of wet adhesion have evolved in several aquatic organisms over millions of years. Yet, the repertoire of synthetic biocompatible wet adhesive materials is still limited. The byssus is a well-studied proteinaceous bioadhesive structure utilized by several bivalves to support sessile lifestyles in turbulent conditions. The quagga mussel (Dreissena bugensis) is a freshwater byssate and a notorious invasive species in the Great Lakes region. To identify adhesive proteins in the quagga mussel byssus, we utilized quantitative proteomics and found several proteins enriched at the byssus-substrate interface. Among the identified proteins was the Dbfp7 protein family. Dbfp7 is a small, polymorphic, and mostly disordered protein that lacks significant amounts of 3,4-dihydroxyphenylalanine (DOPA), a modified amino acid found in several marine mussel byssal proteins. Atomic force microscopy nanomechanical mapping of Dbfp7 films demonstrates that this protein exhibits adhesive ability in aqueous conditions. While DOPA is critical for marine mussel adhesion, interfacial electrochemistry of freshwater adhesive plaques suggests that freshwater byssates circumvent catechol-based adhesion. The functional characterization of Dbfp7 as a freshwater mussel adhesive protein advances the understanding of fundamental requirements for biocompatible wet adhesion, a crucial step for the development of bioinspired wet adhesive materials, such as improved medical adhesives.
Additional Links: PMID-41802065
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41802065,
year = {2026},
author = {Obille, AR and Hasan, R and Rees, DJ and Ng, J and Wang, ZY and Bagchi, R and Lian, K and Carneiro, KMM and Sone, ED},
title = {Identification and characterization of a wet adhesive protein extracted from Dreissena bugensis, the freshwater quagga mussel.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {123},
number = {11},
pages = {e2537453123},
doi = {10.1073/pnas.2537453123},
pmid = {41802065},
issn = {1091-6490},
support = {RGPIN-2019-06210//Natural Sciences and Engineering Research Council of Canada (NSERC)/ ; RGPIN-2025-07042//Natural Sciences and Engineering Research Council of Canada (NSERC)/ ; },
mesh = {Animals ; *Proteins/chemistry/isolation & purification/metabolism ; *Dreissena/chemistry/metabolism ; Fresh Water ; *Adhesives/chemistry ; Proteomics ; Microscopy, Atomic Force ; Dihydroxyphenylalanine/chemistry ; Adhesiveness ; Bivalvia ; },
abstract = {Mechanisms of wet adhesion have evolved in several aquatic organisms over millions of years. Yet, the repertoire of synthetic biocompatible wet adhesive materials is still limited. The byssus is a well-studied proteinaceous bioadhesive structure utilized by several bivalves to support sessile lifestyles in turbulent conditions. The quagga mussel (Dreissena bugensis) is a freshwater byssate and a notorious invasive species in the Great Lakes region. To identify adhesive proteins in the quagga mussel byssus, we utilized quantitative proteomics and found several proteins enriched at the byssus-substrate interface. Among the identified proteins was the Dbfp7 protein family. Dbfp7 is a small, polymorphic, and mostly disordered protein that lacks significant amounts of 3,4-dihydroxyphenylalanine (DOPA), a modified amino acid found in several marine mussel byssal proteins. Atomic force microscopy nanomechanical mapping of Dbfp7 films demonstrates that this protein exhibits adhesive ability in aqueous conditions. While DOPA is critical for marine mussel adhesion, interfacial electrochemistry of freshwater adhesive plaques suggests that freshwater byssates circumvent catechol-based adhesion. The functional characterization of Dbfp7 as a freshwater mussel adhesive protein advances the understanding of fundamental requirements for biocompatible wet adhesion, a crucial step for the development of bioinspired wet adhesive materials, such as improved medical adhesives.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Proteins/chemistry/isolation & purification/metabolism
*Dreissena/chemistry/metabolism
Fresh Water
*Adhesives/chemistry
Proteomics
Microscopy, Atomic Force
Dihydroxyphenylalanine/chemistry
Adhesiveness
Bivalvia
RevDate: 2026-03-10
CmpDate: 2026-03-10
Abiotic and biotic controls of non-native perennial plant success in drylands.
Nature ecology & evolution, 10(3):523-535.
Drivers of non-native plant success in drylands are poorly understood. Here we identify functional differences between dryland native and non-native perennial plants and assess how biotic, abiotic and anthropogenic factors shape the success of the latter. On the basis of plant community and functional trait data from 98 sites across 25 countries, we report a total of 41 non-native plant species at 31 sites. Non-natives tend towards faster growth strategies than natives. Non-native plant richness is higher at sites with greater grazing pressure and under environmental conditions associated with higher soil fertility, decomposition and fungal richness-conditions that tend to occur in less arid regions-and lower where native plant and herbivore richness are greater. Non-native plant cover correlates positively with grazing pressure and negatively with native plant richness. Taken together, our results suggest that non-native plant success in drylands is facilitated when high grazing pressure coincides with elevated resource availability. Such context-dependence of non-native plant success and linkages with native plant and herbivore diversity highlight the need for managing grazing and conserving biodiversity across the world's drylands.
Additional Links: PMID-41652005
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41652005,
year = {2026},
author = {Rahmanian, S and Eisenhauer, N and Huang, Y and Hejda, M and Pyšek, P and Feilhauer, H and Eldridge, DJ and Gross, N and Le Bagousse-Pinguet, Y and Saiz, H and Delgado-Baquerizo, M and Berdugo, M and Ochoa, V and Gozalo, B and Asensio, S and Guirado, E and Valencia, E and García-Gómez, M and Gaitán, JJ and Mendoza, B and Plaza, C and Díaz-Martínez, P and Martínez-Valderrama, J and Abedi, M and Ahmadian, N and Ahumada, RJ and Amghar, F and Araújo, T and Arroyo, AI and Ben Salem, F and Blaum, N and Boldbat, E and Boldgiv, B and Bowker, M and van den Brink, L and Bu, C and Canessa, R and Castillo-Monroy, AP and Castro, H and Castro-Quezada, P and Chaieb, G and Chibani, R and Conceição, AA and Davila, YC and Deák, B and Donoso, DA and Dougill, A and Espinosa, CI and Fajardo, A and Farzam, M and Ferrante, D and Franzese, J and Fraser, LH and Geiger, E and Gonzalez, SL and Montalván, EG and Hering, R and Marais, E and Hernández Hernández, RM and Hernández-Valdez, SD and Hölzel, N and Huber-Sannwald, E and Jadán, O and Jentsch, A and Kindermann, L and Köbel, M and le Roux, PC and Leder, CV and Li, X and Liancourt, P and Linstädter, A and Liu, J and Louw, MA and Maggs-Kölling, G and Makhalanyane, TP and Issa, OM and Manzaneda, AJ and Margerie, P and Martin, R and McClaran, MP and Messeder, JVS and Mora, JP and Moreno, G and Munson, SM and Nair, GR and Nunes, A and Oliva, G and Palpurina, S and Peter, G and Pueyo, Y and Quiroga, E and Reed, SC and Rey, PJ and Rodríguez, A and Rolo, V and Ruppert, JC and Salah, A and Sarig, S and Singh, BK and Swemmer, A and Teixido, AL and Thomas, AD and Tielbörger, K and Travers, S and Valkó, O and Wamiti, W and Wang, D and Wang, L and Wardle, GM and Wolff, P and Yahdjian, L and Oñatibia, GR and Yari, R and Zaady, E and Zhang, Y and Zhou, X and Maestre, FT},
title = {Abiotic and biotic controls of non-native perennial plant success in drylands.},
journal = {Nature ecology & evolution},
volume = {10},
number = {3},
pages = {523-535},
pmid = {41652005},
issn = {2397-334X},
support = {346001466//Alexander von Humboldt-Stiftung (Alexander von Humboldt Foundation)/ ; [German Research Foundation, DFG]-FZT 118, 202548816)//Deutsche Forschungsgemeinschaft (German Research Foundation)/ ; Ei 862/29-1; FOR 5000, 422440326//Deutsche Forschungsgemeinschaft (German Research Foundation)/ ; ([German Research Foundation, DFG]-FZT 118, 202548816//Deutsche Forschungsgemeinschaft (German Research Foundation)/ ; DFG (Ei 862/29-1; FOR 5000, 422440326//Deutsche Forschungsgemeinschaft (German Research Foundation)/ ; RVO 67985939//Akademie Věd České Republiky (Academy of Sciences of the Czech Republic)/ ; grant no. 41971131//National Natural Science Foundation of China (National Science Foundation of China)/ ; The 111 Project (D23029)//Ministerium für Wissenschaft, Forschung und Kunst Baden-Württemberg (Ministry of Science, Research and Art Baden-Württemberg)/ ; EAR-1554894 and DEB-2406931//National Science Foundation (NSF)/ ; ERC grant 647038 (BIODESERT)//EC | EU Framework Programme for Research and Innovation H2020 | H2020 Priority Excellent Science | H2020 European Research Council (H2020 Excellent Science - European Research Council)/ ; (CIDEGENT/2018/041)//Generalitat Valenciana (Regional Government of Valencia)/ ; },
mesh = {Herbivory ; *Biodiversity ; *Introduced Species ; *Plants/classification ; *Plant Physiological Phenomena ; },
abstract = {Drivers of non-native plant success in drylands are poorly understood. Here we identify functional differences between dryland native and non-native perennial plants and assess how biotic, abiotic and anthropogenic factors shape the success of the latter. On the basis of plant community and functional trait data from 98 sites across 25 countries, we report a total of 41 non-native plant species at 31 sites. Non-natives tend towards faster growth strategies than natives. Non-native plant richness is higher at sites with greater grazing pressure and under environmental conditions associated with higher soil fertility, decomposition and fungal richness-conditions that tend to occur in less arid regions-and lower where native plant and herbivore richness are greater. Non-native plant cover correlates positively with grazing pressure and negatively with native plant richness. Taken together, our results suggest that non-native plant success in drylands is facilitated when high grazing pressure coincides with elevated resource availability. Such context-dependence of non-native plant success and linkages with native plant and herbivore diversity highlight the need for managing grazing and conserving biodiversity across the world's drylands.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Herbivory
*Biodiversity
*Introduced Species
*Plants/classification
*Plant Physiological Phenomena
RevDate: 2026-03-10
CmpDate: 2026-03-10
The role of intraspecific crop-weed hybridization in the evolution of weediness and invasiveness: Cultivated and weedy radish (Raphanus sativus) as a case study.
American journal of botany, 110(9):e16217.
PREMISE: The phenotype of hybrids between a crop and its wild or weed counterpart is usually intermediate and maladapted compared to that of their parents; however, hybridization has sometimes been associated with increased fitness, potentially leading to enhanced weediness and invasiveness. Since the ecological context and maternal genetic effects may affect hybrid fitness, they could influence the evolutionary outcomes of hybridization. Here, we evaluated the performance of first-generation crop-weed hybrids of Raphanus sativus and their parents in two contrasting ecological conditions.
METHODS: Using experimental hybridization and outdoor common garden experiments, we assessed differences in time to flowering, survival to maturity, plant biomass, and reproductive components between bidirectional crop-weed hybrids and their parents in agrestal (wheat cultivation, fertilization, weeding) and ruderal (human-disturbed, uncultivated area) conditions over 2 years.
RESULTS: Crop, weeds, and bidirectional hybrids overlapped at least partially during the flowering period, indicating a high probability of gene flow. Hybrids survived to maturity at rates at least as successful as their parents and had higher plant biomass and fecundity, which resulted in higher fitness compared to their parents in both environments, without any differences associated with the direction of the hybridization.
CONCLUSIONS: Intraspecific crop-weed hybridization, regardless of the cross direction, has the potential to promote weediness in weedy R. sativus in agrestal and ruderal environments, increasing the chances for introgression of crop alleles into weed populations. This is the first report of intraspecific crop-weed hybridization in R. sativus.
Additional Links: PMID-37659092
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid37659092,
year = {2023},
author = {Vercellino, RB and Hernández, F and Presotto, A},
title = {The role of intraspecific crop-weed hybridization in the evolution of weediness and invasiveness: Cultivated and weedy radish (Raphanus sativus) as a case study.},
journal = {American journal of botany},
volume = {110},
number = {9},
pages = {e16217},
doi = {10.1002/ajb2.16217},
pmid = {37659092},
issn = {1537-2197},
mesh = {*Raphanus/genetics/physiology/growth & development ; *Hybridization, Genetic ; *Plant Weeds/genetics/physiology ; *Crops, Agricultural/genetics/physiology ; Introduced Species ; *Biological Evolution ; Biomass ; },
abstract = {PREMISE: The phenotype of hybrids between a crop and its wild or weed counterpart is usually intermediate and maladapted compared to that of their parents; however, hybridization has sometimes been associated with increased fitness, potentially leading to enhanced weediness and invasiveness. Since the ecological context and maternal genetic effects may affect hybrid fitness, they could influence the evolutionary outcomes of hybridization. Here, we evaluated the performance of first-generation crop-weed hybrids of Raphanus sativus and their parents in two contrasting ecological conditions.
METHODS: Using experimental hybridization and outdoor common garden experiments, we assessed differences in time to flowering, survival to maturity, plant biomass, and reproductive components between bidirectional crop-weed hybrids and their parents in agrestal (wheat cultivation, fertilization, weeding) and ruderal (human-disturbed, uncultivated area) conditions over 2 years.
RESULTS: Crop, weeds, and bidirectional hybrids overlapped at least partially during the flowering period, indicating a high probability of gene flow. Hybrids survived to maturity at rates at least as successful as their parents and had higher plant biomass and fecundity, which resulted in higher fitness compared to their parents in both environments, without any differences associated with the direction of the hybridization.
CONCLUSIONS: Intraspecific crop-weed hybridization, regardless of the cross direction, has the potential to promote weediness in weedy R. sativus in agrestal and ruderal environments, increasing the chances for introgression of crop alleles into weed populations. This is the first report of intraspecific crop-weed hybridization in R. sativus.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Raphanus/genetics/physiology/growth & development
*Hybridization, Genetic
*Plant Weeds/genetics/physiology
*Crops, Agricultural/genetics/physiology
Introduced Species
*Biological Evolution
Biomass
RevDate: 2026-03-10
CmpDate: 2026-03-10
Modelled dispersal pathways of non-indigenous species in the Danish Wadden Sea.
Marine environmental research, 191:106111.
The introduction-rate of non-indigenous species (NIS) to coastal water bodies has accelerated over the last century. We present a model study assessing the fate of NIS released in likely point sources of the Danish Wadden Sea. We show that NIS-particles released in the deep North Sea are generally transported away from the Wadden Sea, while those released in the coastal North Sea and the Wadden Sea show large variability in track pattern and settlement location. Consequently, the introduction of NIS from ships entering the port of Esbjerg pose a threat to the Wadden Sea through primary and secondary spreading, while transport of species from sources in the south likely causes a slow and steady settling of NIS in the Wadden Sea and coastal North Sea. The study points to the importance of enforcing an efficient monitoring system to ensure early detection of changes to the species composition of the Wadden Sea.
Additional Links: PMID-37573739
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid37573739,
year = {2023},
author = {Schourup-Kristensen, V and Larsen, J and Stæhr, PAU and Maar, M},
title = {Modelled dispersal pathways of non-indigenous species in the Danish Wadden Sea.},
journal = {Marine environmental research},
volume = {191},
number = {},
pages = {106111},
doi = {10.1016/j.marenvres.2023.106111},
pmid = {37573739},
issn = {1879-0291},
mesh = {Denmark ; *Introduced Species ; *Environmental Monitoring/methods ; *Models, Theoretical ; Animals ; North Sea ; *Aquatic Organisms/physiology ; *Animal Distribution ; Models, Biological ; },
abstract = {The introduction-rate of non-indigenous species (NIS) to coastal water bodies has accelerated over the last century. We present a model study assessing the fate of NIS released in likely point sources of the Danish Wadden Sea. We show that NIS-particles released in the deep North Sea are generally transported away from the Wadden Sea, while those released in the coastal North Sea and the Wadden Sea show large variability in track pattern and settlement location. Consequently, the introduction of NIS from ships entering the port of Esbjerg pose a threat to the Wadden Sea through primary and secondary spreading, while transport of species from sources in the south likely causes a slow and steady settling of NIS in the Wadden Sea and coastal North Sea. The study points to the importance of enforcing an efficient monitoring system to ensure early detection of changes to the species composition of the Wadden Sea.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Denmark
*Introduced Species
*Environmental Monitoring/methods
*Models, Theoretical
Animals
North Sea
*Aquatic Organisms/physiology
*Animal Distribution
Models, Biological
RevDate: 2026-03-09
CmpDate: 2026-03-09
A Global Conservation Blind Spot: Neglect of Bryophytes Undermines Biodiversity Targets.
Global change biology, 32(3):e70789.
The global biodiversity crisis is unevenly documented, with conservation assessments heavily biased toward vertebrates and flowering plants. Terrestrial gametophyte-dominant plants (i.e., bryophytes), with over 20,000 species and representing one of Earth's oldest radiations, remain among the most overlooked. To quantify this gap, we integrated global distribution records, elevation patterns, IUCN datasets, research trends, and threat meta-analyzes. Thirty-seven bryophyte-rich regions and global elevational patterns were identified. We found only 1.5% of bryophyte species have been assessed by the IUCN Red List, and among these assessed species, over half are threatened, nearly twice the global average for plants. Agriculture and climate change emerged as the dominant extinction drivers worldwide, while threats vary regionally: deforestation threatens bryophyte diversity in Africa and South America, while climate change and invasive species are the primary threats in Europe. Without targeted, region-specific conservation strategies, accelerating bryophyte decline will undermine biodiversity targets and jeopardize essential ecosystem functions.
Additional Links: PMID-41800856
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41800856,
year = {2026},
author = {Yin, X and Liu, Y and Kong, F and Shu, L and Peng, C and Ang, LP},
title = {A Global Conservation Blind Spot: Neglect of Bryophytes Undermines Biodiversity Targets.},
journal = {Global change biology},
volume = {32},
number = {3},
pages = {e70789},
doi = {10.1111/gcb.70789},
pmid = {41800856},
issn = {1365-2486},
support = {2023JBGS05//Research Project of Baishanzu National Park/ ; 46623-1//Rufford Foundation/ ; },
mesh = {*Biodiversity ; *Conservation of Natural Resources ; *Bryophyta/physiology ; Climate Change ; },
abstract = {The global biodiversity crisis is unevenly documented, with conservation assessments heavily biased toward vertebrates and flowering plants. Terrestrial gametophyte-dominant plants (i.e., bryophytes), with over 20,000 species and representing one of Earth's oldest radiations, remain among the most overlooked. To quantify this gap, we integrated global distribution records, elevation patterns, IUCN datasets, research trends, and threat meta-analyzes. Thirty-seven bryophyte-rich regions and global elevational patterns were identified. We found only 1.5% of bryophyte species have been assessed by the IUCN Red List, and among these assessed species, over half are threatened, nearly twice the global average for plants. Agriculture and climate change emerged as the dominant extinction drivers worldwide, while threats vary regionally: deforestation threatens bryophyte diversity in Africa and South America, while climate change and invasive species are the primary threats in Europe. Without targeted, region-specific conservation strategies, accelerating bryophyte decline will undermine biodiversity targets and jeopardize essential ecosystem functions.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Biodiversity
*Conservation of Natural Resources
*Bryophyta/physiology
Climate Change
RevDate: 2026-03-09
CmpDate: 2026-03-09
Commercial resource potential of an invasive sea cucumber: nutritional analysis of Synaptula reciprocans.
PeerJ, 14:e20466.
BACKGROUND: Synaptula reciprocans, originally native to the Indo-Pacific region, is widespread in the Red Sea. The species entered the Mediterranean during the 1970s and 1980s and has been reported along the Turkish coastline since 2003, where it has established invasive populations. European Union Regulation No. 1143/2014 encourages the investigation of alternative uses and the assessment of the economic potential of invasive species as part of management and control strategies. This study aims to evaluate the nutritional value and elemental composition of S. reciprocans, an invasive species in the Mediterranean, in order to assess its suitability for human consumption and potential alternative applications.
METHODS: S. reciprocans were sampled from two different stations (L1: Gokova Bay and L2: Gulluk Bay) over two seasons, as winter (S1) and summer (S2), and transported to the laboratory under cold chain conditions (+4 °C). Moisture, ash, crude protein, crude fat, fatty acid, amino acid, and elemental content analyses were performed using standardized methods, including gravimetric, Kjeldahl, GC/MS, LC/MS-MS, and ICP-OES techniques.
RESULTS: The findings indicate that both locality and season significantly influence the species' nutritional properties (p < 0.05). Dry matter content exhibited considerable variation across seasons, with the highest concentration observed in L2/S2 and L2/S1. Crude protein levels peaked in winter across both regions (L2S1, L1S1), while fat content was consistently higher in Bodrum samples compared to Gokova (p < 0.05). Ash content was highest in Gokova across both seasonal periods (p < 0.05). The fatty acid profile demonstrated notable seasonal and regional differences (p < 0.05), with linoleic acid (C 18:2) emerging as the predominant polyunsaturated ω-6 fatty acid. Additionally, amino acid analysis revealed significant variation (p < 0.05), identifying alanine, asparagine, glutamine, and proline as the dominant amino acids. Elemental analysis highlighted the absence of copper (Cu) in all sampled tissues, while sodium (Na) was consistently the most abundant mineral.
Additional Links: PMID-41800122
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41800122,
year = {2026},
author = {Ciftcioglu, M and Kesbiç, OS and Filiz, H and Ağdamar, S},
title = {Commercial resource potential of an invasive sea cucumber: nutritional analysis of Synaptula reciprocans.},
journal = {PeerJ},
volume = {14},
number = {},
pages = {e20466},
pmid = {41800122},
issn = {2167-8359},
mesh = {Animals ; *Nutritive Value ; *Introduced Species ; *Sea Cucumbers/chemistry ; Seasons ; Fatty Acids/analysis ; Amino Acids/analysis ; Mediterranean Sea ; },
abstract = {BACKGROUND: Synaptula reciprocans, originally native to the Indo-Pacific region, is widespread in the Red Sea. The species entered the Mediterranean during the 1970s and 1980s and has been reported along the Turkish coastline since 2003, where it has established invasive populations. European Union Regulation No. 1143/2014 encourages the investigation of alternative uses and the assessment of the economic potential of invasive species as part of management and control strategies. This study aims to evaluate the nutritional value and elemental composition of S. reciprocans, an invasive species in the Mediterranean, in order to assess its suitability for human consumption and potential alternative applications.
METHODS: S. reciprocans were sampled from two different stations (L1: Gokova Bay and L2: Gulluk Bay) over two seasons, as winter (S1) and summer (S2), and transported to the laboratory under cold chain conditions (+4 °C). Moisture, ash, crude protein, crude fat, fatty acid, amino acid, and elemental content analyses were performed using standardized methods, including gravimetric, Kjeldahl, GC/MS, LC/MS-MS, and ICP-OES techniques.
RESULTS: The findings indicate that both locality and season significantly influence the species' nutritional properties (p < 0.05). Dry matter content exhibited considerable variation across seasons, with the highest concentration observed in L2/S2 and L2/S1. Crude protein levels peaked in winter across both regions (L2S1, L1S1), while fat content was consistently higher in Bodrum samples compared to Gokova (p < 0.05). Ash content was highest in Gokova across both seasonal periods (p < 0.05). The fatty acid profile demonstrated notable seasonal and regional differences (p < 0.05), with linoleic acid (C 18:2) emerging as the predominant polyunsaturated ω-6 fatty acid. Additionally, amino acid analysis revealed significant variation (p < 0.05), identifying alanine, asparagine, glutamine, and proline as the dominant amino acids. Elemental analysis highlighted the absence of copper (Cu) in all sampled tissues, while sodium (Na) was consistently the most abundant mineral.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Nutritive Value
*Introduced Species
*Sea Cucumbers/chemistry
Seasons
Fatty Acids/analysis
Amino Acids/analysis
Mediterranean Sea
RevDate: 2026-03-09
CmpDate: 2026-03-09
Integrating landscape ecology into generic surveillance plans for bark- and wood-boring beetles.
Ecological applications : a publication of the Ecological Society of America, 36(2):e70194.
International trade poses a growing threat to global biosecurity, with bark- and wood-boring beetles representing a major concern for forest health. Non-native species are frequently introduced at points of entry, where populations can establish in the surrounding landscape. To improve early detection, generic surveillance programs use traps in these high-risk areas, collecting a broad spectrum of species. These traps also capture native beetles, providing insights into the potential species pool that could become exotic elsewhere. However, implementing effective landscape-wide surveillance within reasonable resource limits remains challenging. In this study, we used trapping data of Cerambycidae and Scolytinae from 11 high-risk areas across Europe and North America to develop practical recommendations for generic surveillance at multiple spatial scales. Specifically, we attempted to address two key questions: (1) how to maximize the single-trap efficacy depending on the trap surroundings; and (2) how many traps should be used in a landscape-wide sampling depending on landscape composition. Under budget constraints, we recommend prioritizing trap placement within forest patches and avoiding locations surrounded by roads or buildings. Urban-dominated landscapes required greater sampling effort (i.e., more traps) than forest-dominated landscapes. Deploying fewer than four traps per square kilometer might lead to an incomplete representation of the local bark- and wood-boring beetle community, losing about 30%-50% of species. Overall, our findings highlight the importance of incorporating landscape ecology into generic surveillance planning to optimize trap effectiveness within resource limitations.
Additional Links: PMID-41797626
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41797626,
year = {2026},
author = {Nardi, D and Rassati, D and Battisti, A and Branco, M and Courtin, C and Faccoli, M and Feddern, N and Francese, JA and Franzen, E and Garcia, A and Giannone, F and Gossner, MM and Jonsell, M and Kostanowicz, C and Marchioro, M and Martinek, P and Ray, AM and Roques, A and Sweeney, J and Van Rooyen, K and Webster, V and Marini, L},
title = {Integrating landscape ecology into generic surveillance plans for bark- and wood-boring beetles.},
journal = {Ecological applications : a publication of the Ecological Society of America},
volume = {36},
number = {2},
pages = {e70194},
doi = {10.1002/eap.70194},
pmid = {41797626},
issn = {1051-0761},
support = {AP18PPQS&T00C164//Animal and Plant Health Inspection Service/ ; AP18PPQS&T00C169//Animal and Plant Health Inspection Service/ ; AP19PPQS&T00C082//Animal and Plant Health Inspection Service/ ; 771271//Horizon 2020 Framework Programme/ ; UID/00239//Fundação para a Ciência e a Tecnologia/ ; //Canadian Forest Service, Forest Pest Risk Management Program/ ; 101134200//HORIZON EUROPE Climate, Energy and Mobility/ ; },
mesh = {Animals ; *Coleoptera/physiology ; Wood ; *Environmental Monitoring/methods ; *Ecosystem ; Forests ; },
abstract = {International trade poses a growing threat to global biosecurity, with bark- and wood-boring beetles representing a major concern for forest health. Non-native species are frequently introduced at points of entry, where populations can establish in the surrounding landscape. To improve early detection, generic surveillance programs use traps in these high-risk areas, collecting a broad spectrum of species. These traps also capture native beetles, providing insights into the potential species pool that could become exotic elsewhere. However, implementing effective landscape-wide surveillance within reasonable resource limits remains challenging. In this study, we used trapping data of Cerambycidae and Scolytinae from 11 high-risk areas across Europe and North America to develop practical recommendations for generic surveillance at multiple spatial scales. Specifically, we attempted to address two key questions: (1) how to maximize the single-trap efficacy depending on the trap surroundings; and (2) how many traps should be used in a landscape-wide sampling depending on landscape composition. Under budget constraints, we recommend prioritizing trap placement within forest patches and avoiding locations surrounded by roads or buildings. Urban-dominated landscapes required greater sampling effort (i.e., more traps) than forest-dominated landscapes. Deploying fewer than four traps per square kilometer might lead to an incomplete representation of the local bark- and wood-boring beetle community, losing about 30%-50% of species. Overall, our findings highlight the importance of incorporating landscape ecology into generic surveillance planning to optimize trap effectiveness within resource limitations.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Coleoptera/physiology
Wood
*Environmental Monitoring/methods
*Ecosystem
Forests
RevDate: 2026-03-09
CmpDate: 2026-03-09
Faecal DNA detection and molecular identification of nematodes of veterinary relevance in invasive raccoons and raccoon dogs in Central Europe.
Veterinary parasitology, 343:110727.
Invasive carnivores such as the raccoon (Procyon lotor) and raccoon dog (Nyctereutes procyonoides) are widespread in Europe and may contribute to the circulation of nematodes of veterinary and zoonotic relevance at the wildlife-domestic animal interface. Molecular data on nematode taxa infecting these hosts in Central Europe remain scarce, particularly those derived from faecal DNA. We analysed 212 post-mortem faecal samples collected in western Poland (97 raccoons, 115 raccoon dogs) using PCR-based screening followed by mitochondrial cytochrome c oxidase subunit 1 (cox1) sequencing for molecular identification and phylogenetic analysis. Nematode DNA was detected in 46/212 samples (21.7%), representing minimum detection frequencies rather than true prevalence. In raccoon dogs, sequences of Uncinaria stenocephala, Toxocara canis and Crenosoma spp. were identified, with Molineus sp. representing the most frequently detected taxon. In raccoons, cox1 sequences indicated Strongyloides sp., T. canis and Molineus sp., together with several lineages that could not be reliably assigned due to limited representation of wildlife-associated nematodes in public databases. DNA of Baylisascaris procyonis was not detected. Mitochondrial cox1 sequences obtained from morphologically identified adult Molineus specimens were identical to those recovered from faecal samples, providing the first reference sequences for this genus. Overall, this study provides baseline molecular data on nematode taxa circulating in invasive carnivores in Central Europe and demonstrates the utility of faecal DNA for qualitative surveillance of nematodes of veterinary relevance.
Additional Links: PMID-41762534
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41762534,
year = {2026},
author = {Buńkowska-Gawlik, K and Hildebrand, J and Popiołek, M and Perec-Matysiak, A},
title = {Faecal DNA detection and molecular identification of nematodes of veterinary relevance in invasive raccoons and raccoon dogs in Central Europe.},
journal = {Veterinary parasitology},
volume = {343},
number = {},
pages = {110727},
doi = {10.1016/j.vetpar.2026.110727},
pmid = {41762534},
issn = {1873-2550},
mesh = {Animals ; *Raccoons/parasitology ; *Feces/parasitology ; *Raccoon Dogs/parasitology ; *DNA, Helminth/genetics/isolation & purification ; Poland/epidemiology ; Phylogeny ; *Nematode Infections/veterinary/epidemiology/parasitology ; Introduced Species ; *Nematoda/genetics/isolation & purification/classification ; Electron Transport Complex IV/genetics ; },
abstract = {Invasive carnivores such as the raccoon (Procyon lotor) and raccoon dog (Nyctereutes procyonoides) are widespread in Europe and may contribute to the circulation of nematodes of veterinary and zoonotic relevance at the wildlife-domestic animal interface. Molecular data on nematode taxa infecting these hosts in Central Europe remain scarce, particularly those derived from faecal DNA. We analysed 212 post-mortem faecal samples collected in western Poland (97 raccoons, 115 raccoon dogs) using PCR-based screening followed by mitochondrial cytochrome c oxidase subunit 1 (cox1) sequencing for molecular identification and phylogenetic analysis. Nematode DNA was detected in 46/212 samples (21.7%), representing minimum detection frequencies rather than true prevalence. In raccoon dogs, sequences of Uncinaria stenocephala, Toxocara canis and Crenosoma spp. were identified, with Molineus sp. representing the most frequently detected taxon. In raccoons, cox1 sequences indicated Strongyloides sp., T. canis and Molineus sp., together with several lineages that could not be reliably assigned due to limited representation of wildlife-associated nematodes in public databases. DNA of Baylisascaris procyonis was not detected. Mitochondrial cox1 sequences obtained from morphologically identified adult Molineus specimens were identical to those recovered from faecal samples, providing the first reference sequences for this genus. Overall, this study provides baseline molecular data on nematode taxa circulating in invasive carnivores in Central Europe and demonstrates the utility of faecal DNA for qualitative surveillance of nematodes of veterinary relevance.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Raccoons/parasitology
*Feces/parasitology
*Raccoon Dogs/parasitology
*DNA, Helminth/genetics/isolation & purification
Poland/epidemiology
Phylogeny
*Nematode Infections/veterinary/epidemiology/parasitology
Introduced Species
*Nematoda/genetics/isolation & purification/classification
Electron Transport Complex IV/genetics
RevDate: 2026-03-05
CmpDate: 2026-03-05
Evaluation efficacy of filtration + UV-C radiation for ballast water treatment at different salinity.
Journal of environmental management, 401:128921.
In recent years, the issue of invasive alien species brought on by ballast water has drawn increasing attention, and advances in ballast water treatment technologies have been made. One of the most popular combined ballast water treatment technologies utilized in ballast water management systems globally is filtration + UV-C radiation. In this work, we compared the effectiveness of filtration + UV technology in treating plankton in ballast water with various salinity. The final biological density of ballast water treated by filtration + UV process with different salinity could meet the biological discharge standard required by D-2 standard. UV-C irradiation (It mainly acts on phytoplankton) is more sensitive to salinity than filtration (It mainly acts on phytoplankton).
Additional Links: PMID-41679063
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41679063,
year = {2026},
author = {He, Z and Xue, M and Wang, Y and Tian, Z and Wu, H},
title = {Evaluation efficacy of filtration + UV-C radiation for ballast water treatment at different salinity.},
journal = {Journal of environmental management},
volume = {401},
number = {},
pages = {128921},
doi = {10.1016/j.jenvman.2026.128921},
pmid = {41679063},
issn = {1095-8630},
mesh = {*Ultraviolet Rays ; *Filtration ; Salinity ; *Water Purification/methods ; Phytoplankton/radiation effects ; Ships ; },
abstract = {In recent years, the issue of invasive alien species brought on by ballast water has drawn increasing attention, and advances in ballast water treatment technologies have been made. One of the most popular combined ballast water treatment technologies utilized in ballast water management systems globally is filtration + UV-C radiation. In this work, we compared the effectiveness of filtration + UV technology in treating plankton in ballast water with various salinity. The final biological density of ballast water treated by filtration + UV process with different salinity could meet the biological discharge standard required by D-2 standard. UV-C irradiation (It mainly acts on phytoplankton) is more sensitive to salinity than filtration (It mainly acts on phytoplankton).},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Ultraviolet Rays
*Filtration
Salinity
*Water Purification/methods
Phytoplankton/radiation effects
Ships
RevDate: 2026-03-05
CmpDate: 2026-03-05
Plant-based coagulants for sustainable treatment: Insights from a systematic review and their potential application in Brazil.
Journal of environmental management, 401:128973.
Beyond their well-known role in air purification, plants can also act as natural coagulants for water, wastewater, and effluent treatment. This systematic review examined research on plant-based coagulants published between 2000 and 2024 across four databases (Web of Science, Scopus, ScienceDirect, and Taylor & Francis). Of the 895 retrieved articles, 175 met the eligibility criteria and were analyzed by plant species, preparation method, treatment matrix, application scale, and efficiency. Plant-based coagulants showed broad applicability in effluents, followed by water and wastewater, with high removal efficiencies for turbidity (up to 100%), microbiological parameters (80-98%), heavy metals (78-90%), and emerging contaminants (70-88%). Most studies investigated individual coagulants using simple preparation methods such as drying and grinding, though some species (e.g., Moringa oleifera, Aloe vera) enable even more accessible processing. Research remains largely at the bench-scale, with limited pilot applications, underscoring the need for scale-up and real-world validation. Reported benefits include low toxicity, reduced sludge production, and opportunities for using agricultural residues or invasive species. Despite Brazil's vast biodiversity and technical capacity as a BRICS country, few studies have explored its potential, highlighting the need for targeted research to foster sustainable water treatment solutions. Exploring the viability of plant-based coagulants represents not only a scientific challenge but also a strategic opportunity to advance sustainable, low-cost, and locally driven treatment solutions, particularly for biodiversity-rich countries like Brazil.
Additional Links: PMID-41679052
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41679052,
year = {2026},
author = {Puchalski, BS and da Silveira, MK and Soares, EJS and Gonçalves, IL and Freitas, BLS},
title = {Plant-based coagulants for sustainable treatment: Insights from a systematic review and their potential application in Brazil.},
journal = {Journal of environmental management},
volume = {401},
number = {},
pages = {128973},
doi = {10.1016/j.jenvman.2026.128973},
pmid = {41679052},
issn = {1095-8630},
mesh = {Brazil ; *Water Purification/methods ; Wastewater ; *Waste Disposal, Fluid/methods ; *Plants ; Water Pollutants, Chemical ; },
abstract = {Beyond their well-known role in air purification, plants can also act as natural coagulants for water, wastewater, and effluent treatment. This systematic review examined research on plant-based coagulants published between 2000 and 2024 across four databases (Web of Science, Scopus, ScienceDirect, and Taylor & Francis). Of the 895 retrieved articles, 175 met the eligibility criteria and were analyzed by plant species, preparation method, treatment matrix, application scale, and efficiency. Plant-based coagulants showed broad applicability in effluents, followed by water and wastewater, with high removal efficiencies for turbidity (up to 100%), microbiological parameters (80-98%), heavy metals (78-90%), and emerging contaminants (70-88%). Most studies investigated individual coagulants using simple preparation methods such as drying and grinding, though some species (e.g., Moringa oleifera, Aloe vera) enable even more accessible processing. Research remains largely at the bench-scale, with limited pilot applications, underscoring the need for scale-up and real-world validation. Reported benefits include low toxicity, reduced sludge production, and opportunities for using agricultural residues or invasive species. Despite Brazil's vast biodiversity and technical capacity as a BRICS country, few studies have explored its potential, highlighting the need for targeted research to foster sustainable water treatment solutions. Exploring the viability of plant-based coagulants represents not only a scientific challenge but also a strategic opportunity to advance sustainable, low-cost, and locally driven treatment solutions, particularly for biodiversity-rich countries like Brazil.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Brazil
*Water Purification/methods
Wastewater
*Waste Disposal, Fluid/methods
*Plants
Water Pollutants, Chemical
RevDate: 2026-03-09
CmpDate: 2026-03-09
Invasive Lonicera maackii (Dipscales: Caprifoliaceae) supports a depauperate arthropod community.
Environmental entomology, 55(2):.
Invasion by non-native species is a growing threat to ecosystems and economies. In eastern North American woodlands, invasive exotic shrubs are displacing native plants and transforming understory communities. The displacement of native plants by invasive non-natives may reduce the resources available to higher trophic levels by supporting diminished arthropod communities. Despite a conceptual understanding of the potential for invasive shrubs to transform forest communities, little research has focused on characterizing the arthropod communities they support or their impact on higher trophic levels in eastern North American forests. To address this gap, we compared arthropod diversity, abundance, and community composition on a highly invasive shrub in southwestern Ohio, Amur honeysuckle (Lonicera maackii, Maxim., Dipscales: Caprifoliaceae), to a related, ecologically similar, native shrub, blackhaw (Viburnum prunifolium, Linnaeus, Dipscales: Adoxaceae), over a growing season. Relative to the native shrub, we found that L. maackii hosted a depauperate arthropod community overall, with about 25% fewer individuals and 28% fewer species than its native counterpart, V. prunifolium-primarily driven by a smaller herbivore community on L. maackii. In contrast, the abundance and richness of predatory arthropods were similar between the native and invasive shrubs. The arthropod communities on the native and exotic plants broadly overlapped in ordination space; however, community composition varied significantly, albeit modestly. These findings support the prediction that invasive plants support depauperate arthropod communities and provide reduced ecosystem services.
Additional Links: PMID-41475011
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41475011,
year = {2026},
author = {Zakroff, ARA and Stireman Iii, JO},
title = {Invasive Lonicera maackii (Dipscales: Caprifoliaceae) supports a depauperate arthropod community.},
journal = {Environmental entomology},
volume = {55},
number = {2},
pages = {},
doi = {10.1093/ee/nvaf130},
pmid = {41475011},
issn = {1938-2936},
support = {//WestRock Scholars Program of the College of Science and Mathematics at Wright State University and a Five Rivers MetroParks Foundation Ecological Research/ ; },
mesh = {Animals ; *Introduced Species ; *Lonicera/physiology ; *Arthropods/physiology ; Ohio ; *Biodiversity ; },
abstract = {Invasion by non-native species is a growing threat to ecosystems and economies. In eastern North American woodlands, invasive exotic shrubs are displacing native plants and transforming understory communities. The displacement of native plants by invasive non-natives may reduce the resources available to higher trophic levels by supporting diminished arthropod communities. Despite a conceptual understanding of the potential for invasive shrubs to transform forest communities, little research has focused on characterizing the arthropod communities they support or their impact on higher trophic levels in eastern North American forests. To address this gap, we compared arthropod diversity, abundance, and community composition on a highly invasive shrub in southwestern Ohio, Amur honeysuckle (Lonicera maackii, Maxim., Dipscales: Caprifoliaceae), to a related, ecologically similar, native shrub, blackhaw (Viburnum prunifolium, Linnaeus, Dipscales: Adoxaceae), over a growing season. Relative to the native shrub, we found that L. maackii hosted a depauperate arthropod community overall, with about 25% fewer individuals and 28% fewer species than its native counterpart, V. prunifolium-primarily driven by a smaller herbivore community on L. maackii. In contrast, the abundance and richness of predatory arthropods were similar between the native and invasive shrubs. The arthropod communities on the native and exotic plants broadly overlapped in ordination space; however, community composition varied significantly, albeit modestly. These findings support the prediction that invasive plants support depauperate arthropod communities and provide reduced ecosystem services.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Introduced Species
*Lonicera/physiology
*Arthropods/physiology
Ohio
*Biodiversity
RevDate: 2026-03-05
CmpDate: 2025-09-14
A mechanistic statistical approach to infer invasion characteristics of human-dispersed species with complex life cycle.
Ecological monographs, 95(1):.
The rising introduction of invasive species through trade networks threatens biodiversity and ecosystem services. Yet, we have a limited understanding of how transportation networks determine spatiotemporal patterns of range expansion. This knowledge gap may stem from two reasons. First, current analytical models fail to integrate the invader's life-history dynamics with heterogeneity in human-mediated dispersal patterns. Second, classical statistical methods often fail to provide reliable estimates of model parameters, such as time and place of species introduction and life-history characteristics, due to spatial biases in the presence-only records and lack of informative demographic data. To address these gaps, we first formulate an age-structured metapopulation model that uses a probability matrix to emulate human-mediated dispersal patterns. The model reveals that an invader spreads radially along the shortest network path, such that the inter-patch network distances decrease with increasing traffic volume and reproductive value of hitchhikers. Next, we propose a hierarchical Bayesian statistical method to estimate model parameters using presence-only data and prior demographic knowledge. To show the utility of the statistical approach, we analyze zebra mussel (Dreissena polymorpha) expansion in North America through the inland commercial shipping network. Our analysis suggests that zebra mussels might have been introduced before 1981, indicating a lag of five years between time of introduction and first detection in late 1986. Furthermore, using our statistical model we estimated a one in three chance that they were introduced near Kingsville (Ontario, Canada), where they were first reported. We also find survival, fecundity, and dispersal during early life (1-2 years) play a critical role in determining the expansion success of these mollusks. These results underscore the importance of fusing prior scientific knowledge with observation and demographic processes in a Bayesian framework for conceptual and practical understanding of how invasive species spread by human agency.
Additional Links: PMID-40842822
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid40842822,
year = {2025},
author = {Goel, N and Liebhold, AM and Bertelsmeier, C and Hooten, MB and Korolev, KS and Keitt, TH},
title = {A mechanistic statistical approach to infer invasion characteristics of human-dispersed species with complex life cycle.},
journal = {Ecological monographs},
volume = {95},
number = {1},
pages = {},
pmid = {40842822},
issn = {0012-9615},
support = {R01 GM138530/GM/NIGMS NIH HHS/United States ; },
abstract = {The rising introduction of invasive species through trade networks threatens biodiversity and ecosystem services. Yet, we have a limited understanding of how transportation networks determine spatiotemporal patterns of range expansion. This knowledge gap may stem from two reasons. First, current analytical models fail to integrate the invader's life-history dynamics with heterogeneity in human-mediated dispersal patterns. Second, classical statistical methods often fail to provide reliable estimates of model parameters, such as time and place of species introduction and life-history characteristics, due to spatial biases in the presence-only records and lack of informative demographic data. To address these gaps, we first formulate an age-structured metapopulation model that uses a probability matrix to emulate human-mediated dispersal patterns. The model reveals that an invader spreads radially along the shortest network path, such that the inter-patch network distances decrease with increasing traffic volume and reproductive value of hitchhikers. Next, we propose a hierarchical Bayesian statistical method to estimate model parameters using presence-only data and prior demographic knowledge. To show the utility of the statistical approach, we analyze zebra mussel (Dreissena polymorpha) expansion in North America through the inland commercial shipping network. Our analysis suggests that zebra mussels might have been introduced before 1981, indicating a lag of five years between time of introduction and first detection in late 1986. Furthermore, using our statistical model we estimated a one in three chance that they were introduced near Kingsville (Ontario, Canada), where they were first reported. We also find survival, fecundity, and dispersal during early life (1-2 years) play a critical role in determining the expansion success of these mollusks. These results underscore the importance of fusing prior scientific knowledge with observation and demographic processes in a Bayesian framework for conceptual and practical understanding of how invasive species spread by human agency.},
}
RevDate: 2025-08-26
CmpDate: 2025-08-26
Seven years later: native AMF inoculation improves grassland successional stage, floristic quality index, and diversity, while suppressing weeds.
FEMS microbiology letters, 372:.
Reintroducing key soil microbes, such as arbuscular mycorrhizal (AM) fungi, can enhance prairie restoration, but the long-term persistence of these effects is unclear. In 2017, a tallgrass prairie restoration experiment was established that applied an inoculation gradient of native AM fungal inoculant ranging from 0 to 8192 kg/ha. Here, we sample the resulting prairie community establishment and spread seven growing seasons later (72 months). We found that AM fungal application increased total diversity, floristic quality index, and average coefficient of conservatism scores-metrics that assess an area's ecological integrity based on plant species. Moreover, high application densities of native AM fungi reduced non-native plant abundance. Furthermore, inoculated prairie plots were more likely to extend 1.5 m into adjacent nonseeded old-field plots, enhancing native diversity and reducing invasion in marginal lands. These findings highlight the lasting benefits of native AM fungal inoculation in prairie restoration and their potential to facilitate long-term ecosystem recovery, aligning with global biodiversity conservation efforts such as the UN Sustainable Development Goal 15 (Life on Land). Given that land managers spend ~25% of their time and considerable economic input managing invasive species, these findings demonstrate that the reintroducing native AM fungi from reference ecosystems during grassland restoration could provide a cost-effective means of enhancing ecological outcomes.
Additional Links: PMID-40758403
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid40758403,
year = {2025},
author = {Koziol, L and McKenna, TP and Duell, EB and Bever, JD},
title = {Seven years later: native AMF inoculation improves grassland successional stage, floristic quality index, and diversity, while suppressing weeds.},
journal = {FEMS microbiology letters},
volume = {372},
number = {},
pages = {},
doi = {10.1093/femsle/fnaf079},
pmid = {40758403},
issn = {1574-6968},
support = {DBI-2120153//National Science Foundation/ ; BII-2120153//National Science Foundation/ ; PFI 2016549//National Science Foundation/ ; NIFA-AFRI-1003475//United States Department of Agriculture/ ; },
mesh = {*Grassland ; *Mycorrhizae/physiology ; *Biodiversity ; *Soil Microbiology ; *Plant Weeds/growth & development ; Ecosystem ; },
abstract = {Reintroducing key soil microbes, such as arbuscular mycorrhizal (AM) fungi, can enhance prairie restoration, but the long-term persistence of these effects is unclear. In 2017, a tallgrass prairie restoration experiment was established that applied an inoculation gradient of native AM fungal inoculant ranging from 0 to 8192 kg/ha. Here, we sample the resulting prairie community establishment and spread seven growing seasons later (72 months). We found that AM fungal application increased total diversity, floristic quality index, and average coefficient of conservatism scores-metrics that assess an area's ecological integrity based on plant species. Moreover, high application densities of native AM fungi reduced non-native plant abundance. Furthermore, inoculated prairie plots were more likely to extend 1.5 m into adjacent nonseeded old-field plots, enhancing native diversity and reducing invasion in marginal lands. These findings highlight the lasting benefits of native AM fungal inoculation in prairie restoration and their potential to facilitate long-term ecosystem recovery, aligning with global biodiversity conservation efforts such as the UN Sustainable Development Goal 15 (Life on Land). Given that land managers spend ~25% of their time and considerable economic input managing invasive species, these findings demonstrate that the reintroducing native AM fungi from reference ecosystems during grassland restoration could provide a cost-effective means of enhancing ecological outcomes.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Grassland
*Mycorrhizae/physiology
*Biodiversity
*Soil Microbiology
*Plant Weeds/growth & development
Ecosystem
RevDate: 2025-05-19
CmpDate: 2025-02-08
Urban Greening and Pollen Allergy: Balancing Health and Environmental Sustainability.
The journal of allergy and clinical immunology. In practice, 13(2):275-279.
Urban living requires a careful balance between human health and environmental sustainability when selecting urban vegetation. Public gardens and green roofs offer significant environmental benefits, including air filtration, exposure to health-associated microbiota, and mitigation of the urban heat island effect. However, prioritizing allergy-friendly species is crucial to prevent the exacerbation of pollen allergies. This review highlights 3 primary criteria for selecting vegetation that supports these ecosystem services while minimizing allergy risks. First, reducing the use of many wind-pollinated plants, such as birch trees and grasses, is crucial due to their high pollen production and cross-reactivity with other species, which can exacerbate allergies. In contrast, insect-pollinated plants are generally safer for allergy sufferers. Secondly, cultivating multispecies plant communities with minimal maintenance supports habitats for microbiota and invertebrates, further providing ecosystem services. Lastly, balancing plant gender ratios in urban spaces can help control pollen levels. Together these criteria provide a framework for urban planners to create green spaces that are both environmentally beneficial and allergy friendly. Although this review focuses on European data, the principles discussed have global relevance, reinforcing the need to integrate environmental sustainability with public health considerations in urban planning. Future studies should also investigate the health impacts of plant volatile emissions, explore heat-resistant plant varieties, and assess the ecological risks of invasive species to support sustainable, allergy-friendly urban environments.
Additional Links: PMID-39710225
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid39710225,
year = {2025},
author = {Stevanovic, K and Sinkkonen, A and Pawankar, R and Zuberbier, T},
title = {Urban Greening and Pollen Allergy: Balancing Health and Environmental Sustainability.},
journal = {The journal of allergy and clinical immunology. In practice},
volume = {13},
number = {2},
pages = {275-279},
doi = {10.1016/j.jaip.2024.12.017},
pmid = {39710225},
issn = {2213-2201},
mesh = {Humans ; *Pollen/immunology ; *Rhinitis, Allergic, Seasonal/epidemiology/prevention & control/immunology ; Allergens/immunology ; Ecosystem ; Animals ; },
abstract = {Urban living requires a careful balance between human health and environmental sustainability when selecting urban vegetation. Public gardens and green roofs offer significant environmental benefits, including air filtration, exposure to health-associated microbiota, and mitigation of the urban heat island effect. However, prioritizing allergy-friendly species is crucial to prevent the exacerbation of pollen allergies. This review highlights 3 primary criteria for selecting vegetation that supports these ecosystem services while minimizing allergy risks. First, reducing the use of many wind-pollinated plants, such as birch trees and grasses, is crucial due to their high pollen production and cross-reactivity with other species, which can exacerbate allergies. In contrast, insect-pollinated plants are generally safer for allergy sufferers. Secondly, cultivating multispecies plant communities with minimal maintenance supports habitats for microbiota and invertebrates, further providing ecosystem services. Lastly, balancing plant gender ratios in urban spaces can help control pollen levels. Together these criteria provide a framework for urban planners to create green spaces that are both environmentally beneficial and allergy friendly. Although this review focuses on European data, the principles discussed have global relevance, reinforcing the need to integrate environmental sustainability with public health considerations in urban planning. Future studies should also investigate the health impacts of plant volatile emissions, explore heat-resistant plant varieties, and assess the ecological risks of invasive species to support sustainable, allergy-friendly urban environments.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Humans
*Pollen/immunology
*Rhinitis, Allergic, Seasonal/epidemiology/prevention & control/immunology
Allergens/immunology
Ecosystem
Animals
RevDate: 2019-11-20
First Report of Powdery Mildew Caused by Podosphaera leucotricha on Callery Pear in North America.
Plant disease, 94(2):279.
Callery pear, often referred to as Bradford pear, is a species native to China that is planted throughout North America as an ornamental tree for its white flowers in spring, bright colored foliage in autumn, and resistance to disease. In some regions it is becoming an invasive species that is replacing native trees. In May 2009, leaves of Pyrus calleryana 'Cleveland Select' showing distortion and signs of powdery mildew were collected in Columbia (Howard County), Maryland. A survey of the surrounding area found numerous similarly diseased trees of this cultivar. Microscopic observation of the leaves revealed a fungus with an Oidium anamorph having nipple-shaped appressoria; conidiophores erect, foot cells cylindric, straight, of terminal origin, 41 to 55 × 9.5 to 12.5 μm, with the following cells present in variable numbers; conidia catenulate, broadly ellipsoid to rarely slightly ovoid, 22 to 27 × 11 to 17 μm, with fibrosin bodies. Chasmothecia were absent. On the basis of morphology and host, the fungus was identified as Podosphaera leucotricha (Ellis & Everh.) E.S. Salmon (Leotiomycetes, Erysiphales) (1). The specimen on P. calleryana was deposited in the U.S. National Fungus Collections as BPI 879141. Additional confirmation resulted from a comparison of internal transcribed spacer (ITS) region DNA sequence data (GenBank Accession No. GU122230) obtained with the custom designed primer, Podoprimer Forward (5'-3' ACTCGTTCTGCGCGGCTGAC), and the ITS4 primer. The sequence of the fungus on Callery pear was identical to available GenBank sequences of P. leucotricha. P. leucotricha is the etiological agent of a powdery mildew disease that occurs on rosaceous plants, primarily Malus and Pyrus. This fungus occurs nearly worldwide (1), and the pathology of the disease on Callery pear is similar to that of known hosts (1,4). To our knowledge, this is the first report of P. leucotricha on Pyrus calleryana in North America. P. leucotricha has been reported previously only once on Callery pear, Pyrus calleryana 'Chanticleer', in Hungary (4). Additionally, the powdery mildew fungus was heavily parasitized by Ampelomyces quisqualis Ces. sensu lato, a cosmopolitan coelomycetous mycoparasite of the Erysiphales that is well known on this species (2,3). ITS region DNA sequence data from the Ampelomyces (GenBank Accession No. GU122231) obtained with the ITS1 and ITS4 primers was identical to that of other isolates parasitic on P. leucotricha (2). References: (1) U. Braun. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena, Germany, 1995. (2) C. Liang et al. Fungal Divers. 24:225, 2007. (3) B. C. Sutton. The Coelomycetes. Fungi Imperfecti with Pycnidia, Acervuli and Stromata. Commonwealth Mycological Institute, Kew, England, 1980. (4) L. Vajna and L. Kiss. Plant Dis. 92:176, 2008.
Additional Links: PMID-30754298
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid30754298,
year = {2010},
author = {Minnis, AM and Rossman, AY and Clement, DL and Malinoski, MK and Rane, KK},
title = {First Report of Powdery Mildew Caused by Podosphaera leucotricha on Callery Pear in North America.},
journal = {Plant disease},
volume = {94},
number = {2},
pages = {279},
doi = {10.1094/PDIS-94-2-0279B},
pmid = {30754298},
issn = {0191-2917},
abstract = {Callery pear, often referred to as Bradford pear, is a species native to China that is planted throughout North America as an ornamental tree for its white flowers in spring, bright colored foliage in autumn, and resistance to disease. In some regions it is becoming an invasive species that is replacing native trees. In May 2009, leaves of Pyrus calleryana 'Cleveland Select' showing distortion and signs of powdery mildew were collected in Columbia (Howard County), Maryland. A survey of the surrounding area found numerous similarly diseased trees of this cultivar. Microscopic observation of the leaves revealed a fungus with an Oidium anamorph having nipple-shaped appressoria; conidiophores erect, foot cells cylindric, straight, of terminal origin, 41 to 55 × 9.5 to 12.5 μm, with the following cells present in variable numbers; conidia catenulate, broadly ellipsoid to rarely slightly ovoid, 22 to 27 × 11 to 17 μm, with fibrosin bodies. Chasmothecia were absent. On the basis of morphology and host, the fungus was identified as Podosphaera leucotricha (Ellis & Everh.) E.S. Salmon (Leotiomycetes, Erysiphales) (1). The specimen on P. calleryana was deposited in the U.S. National Fungus Collections as BPI 879141. Additional confirmation resulted from a comparison of internal transcribed spacer (ITS) region DNA sequence data (GenBank Accession No. GU122230) obtained with the custom designed primer, Podoprimer Forward (5'-3' ACTCGTTCTGCGCGGCTGAC), and the ITS4 primer. The sequence of the fungus on Callery pear was identical to available GenBank sequences of P. leucotricha. P. leucotricha is the etiological agent of a powdery mildew disease that occurs on rosaceous plants, primarily Malus and Pyrus. This fungus occurs nearly worldwide (1), and the pathology of the disease on Callery pear is similar to that of known hosts (1,4). To our knowledge, this is the first report of P. leucotricha on Pyrus calleryana in North America. P. leucotricha has been reported previously only once on Callery pear, Pyrus calleryana 'Chanticleer', in Hungary (4). Additionally, the powdery mildew fungus was heavily parasitized by Ampelomyces quisqualis Ces. sensu lato, a cosmopolitan coelomycetous mycoparasite of the Erysiphales that is well known on this species (2,3). ITS region DNA sequence data from the Ampelomyces (GenBank Accession No. GU122231) obtained with the ITS1 and ITS4 primers was identical to that of other isolates parasitic on P. leucotricha (2). References: (1) U. Braun. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena, Germany, 1995. (2) C. Liang et al. Fungal Divers. 24:225, 2007. (3) B. C. Sutton. The Coelomycetes. Fungi Imperfecti with Pycnidia, Acervuli and Stromata. Commonwealth Mycological Institute, Kew, England, 1980. (4) L. Vajna and L. Kiss. Plant Dis. 92:176, 2008.},
}
RevDate: 2026-03-03
Drought and fragmentation shape successional trajectories of isolated urban forests in South Korea.
Scientific reports pii:10.1038/s41598-026-42621-w [Epub ahead of print].
Managing urban forest successional trajectories is essential for sustainable and cost-effective ecological restoration. However, successional pathways in South Korea's urban forests are frequently disrupted by environmental and anthropogenic pressures, threatening their long-term sustainability. This study examined successional pathways and their environmental determinants in isolated urban forest patches across seven metropolitan cities. Structural equation modeling was used to assess relationships among environmental variables, canopy structure, and successional pathways, and key drivers were identified using Random Forest analysis. Overall, 83.2% of plots exhibited progressive succession, transitioning from early-successional invasive alien or introduced species toward mid- to late-successional native communities. In contrast, 16.8% of plots underwent retrogressive succession, characterized by shifts from Quercus-dominated stands toward stress-tolerant, urban-adapted species associated with earlier successional or degraded conditions. Drought severity and forest patch size emerged as the primary determinants of successional pathways. These findings demonstrate how climatic stress and spatial constraints linked to fragmentation shape UF dynamics at a regional scale and provide insights for targeted restoration strategies that promote progressive succession and enhance the long-term sustainability of urban forests.
Additional Links: PMID-41776323
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41776323,
year = {2026},
author = {Kim, I and Sou, HD and Kim, JS and Cho, HJ and Jeong, J and Oh, JH and Park, CR},
title = {Drought and fragmentation shape successional trajectories of isolated urban forests in South Korea.},
journal = {Scientific reports},
volume = {},
number = {},
pages = {},
doi = {10.1038/s41598-026-42621-w},
pmid = {41776323},
issn = {2045-2322},
support = {#FE0100202403//National Institute of Forest Science/ ; #FE0100202403//National Institute of Forest Science/ ; #FE0100202403//National Institute of Forest Science/ ; #FE0100202403//National Institute of Forest Science/ ; #FE0100202403//National Institute of Forest Science/ ; #FE0100202403//National Institute of Forest Science/ ; #FE0100202403//National Institute of Forest Science/ ; },
abstract = {Managing urban forest successional trajectories is essential for sustainable and cost-effective ecological restoration. However, successional pathways in South Korea's urban forests are frequently disrupted by environmental and anthropogenic pressures, threatening their long-term sustainability. This study examined successional pathways and their environmental determinants in isolated urban forest patches across seven metropolitan cities. Structural equation modeling was used to assess relationships among environmental variables, canopy structure, and successional pathways, and key drivers were identified using Random Forest analysis. Overall, 83.2% of plots exhibited progressive succession, transitioning from early-successional invasive alien or introduced species toward mid- to late-successional native communities. In contrast, 16.8% of plots underwent retrogressive succession, characterized by shifts from Quercus-dominated stands toward stress-tolerant, urban-adapted species associated with earlier successional or degraded conditions. Drought severity and forest patch size emerged as the primary determinants of successional pathways. These findings demonstrate how climatic stress and spatial constraints linked to fragmentation shape UF dynamics at a regional scale and provide insights for targeted restoration strategies that promote progressive succession and enhance the long-term sustainability of urban forests.},
}
RevDate: 2026-03-08
CmpDate: 2026-03-08
A scoping literature review on the impacts of non-native species on the native terrestrial biodiversity of an oceanic island.
PeerJ, 14:e20839.
BACKGROUND: Many non-native species have been introduced to oceanic islands, with a subset becoming invasive, which pose the greatest threat to native terrestrial biodiversity. Yet, existing information on their impacts, particularly at the island scale, has rarely been synthesised. Addressing this gap is essential for revealing neglected aspects and for prioritising conservation management to optimise the use of scarce resources. Here, we use one volcanic oceanic island as a model to characterise the knowledge landscape about the impacts of non-native species on native biodiversity. Specifically, we (1) inventory the studied mechanisms through which non-native species affect native biodiversity; (2) evaluate the extent to which studies assess impacts at the level of biological organisation and/or biotic interactions; (3) assess the severity of impacts of non-native taxa and (4) highlight research gaps requiring most attention at the island scale.
METHOD: Mauritius was used for a scoping review based on four databases (Dimensions, Google Scholar, ScienceDirect and SpringerLink) to systematically search and identify relevant studies on the impacts of non-native species on native terrestrial biodiversity. We used the Environmental Impact Classification for Alien Taxa (EICAT) framework and its extension, EICAT+ to categorise the impact mechanisms and magnitude of impact. We searched for all records from the inception of each database until November 2023. We included 62 publications in the final analysis, selected from a total of 1,760 articles screened following the PRISMA guidelines for scoping reviews.
RESULTS: We recorded a total of 273 impact records between non-native and native species. Non-native species of plants and mammals were the most common, affecting a wide range of native taxonomic groups. Negative impacts predominated (65.2%), followed by positive impacts (34.1%), with few neutral impacts (0.7%). Competition and predation were the most studied negative impact mechanisms, typically impacting many native species while positive impacts of non-native species were mainly associated with the provision of trophic resources and typically impacted few species. The main impacts of non-native species on native species studied were at the level of biological organisation (N = 169), while only 22 of the impact records investigated their effects on biotic interactions.
CONCLUSION: Limited attention has been given to indirect mechanisms and the impacts of non-native species on biotic interactions. Future studies should prioritise these areas, as indirect mechanisms may reveal cumulative and often insidious pathways through which non-native species accelerate biodiversity loss, especially on islands. Investigating their effects on biotic interactions is critical for detecting cascading impacts to inform more effective and comprehensive conservation strategies.
Additional Links: PMID-41769408
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41769408,
year = {2026},
author = {Seeburrun, G and Baider, C and Bissessur, P and Florens, FBV},
title = {A scoping literature review on the impacts of non-native species on the native terrestrial biodiversity of an oceanic island.},
journal = {PeerJ},
volume = {14},
number = {},
pages = {e20839},
pmid = {41769408},
issn = {2167-8359},
mesh = {*Biodiversity ; *Introduced Species ; Islands ; *Conservation of Natural Resources ; Animals ; },
abstract = {BACKGROUND: Many non-native species have been introduced to oceanic islands, with a subset becoming invasive, which pose the greatest threat to native terrestrial biodiversity. Yet, existing information on their impacts, particularly at the island scale, has rarely been synthesised. Addressing this gap is essential for revealing neglected aspects and for prioritising conservation management to optimise the use of scarce resources. Here, we use one volcanic oceanic island as a model to characterise the knowledge landscape about the impacts of non-native species on native biodiversity. Specifically, we (1) inventory the studied mechanisms through which non-native species affect native biodiversity; (2) evaluate the extent to which studies assess impacts at the level of biological organisation and/or biotic interactions; (3) assess the severity of impacts of non-native taxa and (4) highlight research gaps requiring most attention at the island scale.
METHOD: Mauritius was used for a scoping review based on four databases (Dimensions, Google Scholar, ScienceDirect and SpringerLink) to systematically search and identify relevant studies on the impacts of non-native species on native terrestrial biodiversity. We used the Environmental Impact Classification for Alien Taxa (EICAT) framework and its extension, EICAT+ to categorise the impact mechanisms and magnitude of impact. We searched for all records from the inception of each database until November 2023. We included 62 publications in the final analysis, selected from a total of 1,760 articles screened following the PRISMA guidelines for scoping reviews.
RESULTS: We recorded a total of 273 impact records between non-native and native species. Non-native species of plants and mammals were the most common, affecting a wide range of native taxonomic groups. Negative impacts predominated (65.2%), followed by positive impacts (34.1%), with few neutral impacts (0.7%). Competition and predation were the most studied negative impact mechanisms, typically impacting many native species while positive impacts of non-native species were mainly associated with the provision of trophic resources and typically impacted few species. The main impacts of non-native species on native species studied were at the level of biological organisation (N = 169), while only 22 of the impact records investigated their effects on biotic interactions.
CONCLUSION: Limited attention has been given to indirect mechanisms and the impacts of non-native species on biotic interactions. Future studies should prioritise these areas, as indirect mechanisms may reveal cumulative and often insidious pathways through which non-native species accelerate biodiversity loss, especially on islands. Investigating their effects on biotic interactions is critical for detecting cascading impacts to inform more effective and comprehensive conservation strategies.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Biodiversity
*Introduced Species
Islands
*Conservation of Natural Resources
Animals
RevDate: 2026-03-06
The Microbiome of an Invasive Antarctic insect, Eretmoptera Murphyi (Diptera: Chironomidae), and its Potential Role in Nutrient Cycling.
Microbial ecology, 89(1):.
UNLABELLED: Eretmoptera murphyi Schaeffer 1914 is a flightless chironomid midge endemic to South Georgia in the sub-Antarctic. In the 1960s it was accidentally introduced to Signy Island (in the more extreme maritime Antarctic), where it is now considered an invasive species. Detritivorous E. murphyi larvae can increase soil nitrogen levels by up to five times compared with similar uncolonized substrates, although the mechanisms involved remain unknown. This study conducted the first larval microbiome characterisation of E. murphyi, with the aim of identifying groups of microorganisms that may contribute to the elevated nutrient availability associated with this species. We also compare the E. murphyi microbiome with information available for other Antarctic invertebrates. Dominant archaea and bacteria included Crenarchaeota, Actinobacteriota, Chloroflexi, Proteobacteria and Planctomycetota, many of which have known roles in nutrient cycling. The microbiome of E. murphyi appears more diverse than that of other Antarctic invertebrates studied to date and includes phyla (Chloroflexi and Mycococcota) not previously reported from Signy Island soils or other Antarctic terrestrial invertebrate species. Further research is needed to establish which of these taxa represent true endosymbionts and to confirm their functional roles. The impact of non-native species microbiomes on nutrient cycling has important implications for polar terrestrial ecosystems, as significant changes in nutrient availability could impact native microarthropod and plant communities, as well as open new pathways for future non-native species establishment.
SUPPLEMENTARY INFORMATION: The online version contains supplementary material available at 10.1007/s00248-026-02706-5.
Additional Links: PMID-41764142
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41764142,
year = {2026},
author = {Brayley, ODM and McCready, K and Liu, S and Convey, P and Chen, Y and Ullah, S and Teets, N and Hayward, SAL},
title = {The Microbiome of an Invasive Antarctic insect, Eretmoptera Murphyi (Diptera: Chironomidae), and its Potential Role in Nutrient Cycling.},
journal = {Microbial ecology},
volume = {89},
number = {1},
pages = {},
pmid = {41764142},
issn = {1432-184X},
support = {NE/S007350/1//NERC CENTA2/ ; NE/T009446/1//NSFGEO-NERC/ ; OPP-1850988//National Science Foundation/ ; 700545//USDA National Institute of Food and Agriculture Hatch Project/ ; RF-2024-396/2//Leverhulme Research Fellowship/ ; },
abstract = {UNLABELLED: Eretmoptera murphyi Schaeffer 1914 is a flightless chironomid midge endemic to South Georgia in the sub-Antarctic. In the 1960s it was accidentally introduced to Signy Island (in the more extreme maritime Antarctic), where it is now considered an invasive species. Detritivorous E. murphyi larvae can increase soil nitrogen levels by up to five times compared with similar uncolonized substrates, although the mechanisms involved remain unknown. This study conducted the first larval microbiome characterisation of E. murphyi, with the aim of identifying groups of microorganisms that may contribute to the elevated nutrient availability associated with this species. We also compare the E. murphyi microbiome with information available for other Antarctic invertebrates. Dominant archaea and bacteria included Crenarchaeota, Actinobacteriota, Chloroflexi, Proteobacteria and Planctomycetota, many of which have known roles in nutrient cycling. The microbiome of E. murphyi appears more diverse than that of other Antarctic invertebrates studied to date and includes phyla (Chloroflexi and Mycococcota) not previously reported from Signy Island soils or other Antarctic terrestrial invertebrate species. Further research is needed to establish which of these taxa represent true endosymbionts and to confirm their functional roles. The impact of non-native species microbiomes on nutrient cycling has important implications for polar terrestrial ecosystems, as significant changes in nutrient availability could impact native microarthropod and plant communities, as well as open new pathways for future non-native species establishment.
SUPPLEMENTARY INFORMATION: The online version contains supplementary material available at 10.1007/s00248-026-02706-5.},
}
RevDate: 2025-05-25
CmpDate: 2025-02-27
The impact of climate change in pollen food allergy syndrome.
Current opinion in allergy and clinical immunology, 25(2):129-133.
PURPOSE OF REVIEW: To evaluate the effect of climate change on pollen allergenicity, lengthening of the pollen season, and the spread of invasive species such as ragweed. To assess evidence to determine whether these effects are impacting the prevalence of pollen food syndrome (PFS).
RECENT FINDINGS: There is good evidence to demonstrate that markers of climate change, including rising temperatures and to some extent greenhouse gases, are responsible for a rise in the allergenicity of pollen and an increase in the duration of the pollen season, especially for trees. These changes are likely to be linked to the increase in the prevalence of seasonal allergic rhinitis (SAR), especially in children. Sensitization to pollen, especially tree pollen, is also a risk factor for the development of PFS. Thought to mainly affect adults, recent evidence suggests that there is a rise in the prevalence of PFS in children, linked to an increase in SAR.
SUMMARY: Increasing SAR due to climate change could lead to a greater number of children and adults developing PFS. Although PFS is generally considered to be a mild condition, severe reactions can occur and there might be numerous plant food triggers, which can adversely affect dietary choice and nutritional intake.
Additional Links: PMID-39903212
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid39903212,
year = {2025},
author = {Skypala, IJ},
title = {The impact of climate change in pollen food allergy syndrome.},
journal = {Current opinion in allergy and clinical immunology},
volume = {25},
number = {2},
pages = {129-133},
doi = {10.1097/ACI.0000000000001064},
pmid = {39903212},
issn = {1473-6322},
mesh = {Humans ; *Climate Change ; *Food Hypersensitivity/epidemiology/immunology ; *Rhinitis, Allergic, Seasonal/epidemiology/immunology ; *Pollen/immunology/adverse effects ; *Allergens/immunology ; Prevalence ; Child ; Syndrome ; Adult ; Risk Factors ; Oral Allergy Syndrome ; },
abstract = {PURPOSE OF REVIEW: To evaluate the effect of climate change on pollen allergenicity, lengthening of the pollen season, and the spread of invasive species such as ragweed. To assess evidence to determine whether these effects are impacting the prevalence of pollen food syndrome (PFS).
RECENT FINDINGS: There is good evidence to demonstrate that markers of climate change, including rising temperatures and to some extent greenhouse gases, are responsible for a rise in the allergenicity of pollen and an increase in the duration of the pollen season, especially for trees. These changes are likely to be linked to the increase in the prevalence of seasonal allergic rhinitis (SAR), especially in children. Sensitization to pollen, especially tree pollen, is also a risk factor for the development of PFS. Thought to mainly affect adults, recent evidence suggests that there is a rise in the prevalence of PFS in children, linked to an increase in SAR.
SUMMARY: Increasing SAR due to climate change could lead to a greater number of children and adults developing PFS. Although PFS is generally considered to be a mild condition, severe reactions can occur and there might be numerous plant food triggers, which can adversely affect dietary choice and nutritional intake.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Humans
*Climate Change
*Food Hypersensitivity/epidemiology/immunology
*Rhinitis, Allergic, Seasonal/epidemiology/immunology
*Pollen/immunology/adverse effects
*Allergens/immunology
Prevalence
Child
Syndrome
Adult
Risk Factors
Oral Allergy Syndrome
RevDate: 2026-03-07
CmpDate: 2026-03-07
Invasive Argemone mexicana's suppressive effects on germination and early growth of Triticum aestivum and Hordeum vulgare in South-western Saudi Arabia.
PloS one, 21(3):e0344281.
The invasion of exotic plant species has emerged as a global problem that impacts the ecosystems, economy, and human health, and is the reason for biodiversity loss. Argemone mexicana L. is one of the plants that was recorded as an invasive plant species in south-western Saudi Arabia. Allelochemical properties have been stated but not empirically evaluated on economically important staple crops. In the present study, the phenotype of the A. mexicana L. plant was described using major and minor phenotypic morphology, and morphological seed. Additionally, laboratory experiments were conducted to evaluate the allelopathic effects of water extract of A. mexicana L. on radicle and plumule length of Triticum aestivum and Hordeum vulgare. Results showed that the allelopathic potential of leaf and seed extracts of A. mexicana decreased the seed germination (until 66.66%), plumule length (93.94%-94.94%), and radicle length (96.68%- 96.96%) respectively for T. aestivum and H. vulgare with a rise in extract concentration. Moreover, it was observed that the A. mexicana seed extract is more allelopathically effective than leaf extract. Hence, it could be concluded that the seed and leaf aqueous extracts contain water-soluble allelochemicals, which could inhibit seed germination of T. aestivum and H. vulgare.
Additional Links: PMID-41790771
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41790771,
year = {2026},
author = {Alshaqhaa, MA and Souid, I and Alshehri, MD and Alyahya, N and Msaada, K and Guedri, MM},
title = {Invasive Argemone mexicana's suppressive effects on germination and early growth of Triticum aestivum and Hordeum vulgare in South-western Saudi Arabia.},
journal = {PloS one},
volume = {21},
number = {3},
pages = {e0344281},
pmid = {41790771},
issn = {1932-6203},
mesh = {*Triticum/growth & development/drug effects ; *Germination/drug effects ; *Hordeum/growth & development/drug effects ; Saudi Arabia ; *Plant Extracts/pharmacology ; Seeds/growth & development/chemistry ; Plant Leaves/chemistry ; *Argemone/chemistry ; *Introduced Species ; },
abstract = {The invasion of exotic plant species has emerged as a global problem that impacts the ecosystems, economy, and human health, and is the reason for biodiversity loss. Argemone mexicana L. is one of the plants that was recorded as an invasive plant species in south-western Saudi Arabia. Allelochemical properties have been stated but not empirically evaluated on economically important staple crops. In the present study, the phenotype of the A. mexicana L. plant was described using major and minor phenotypic morphology, and morphological seed. Additionally, laboratory experiments were conducted to evaluate the allelopathic effects of water extract of A. mexicana L. on radicle and plumule length of Triticum aestivum and Hordeum vulgare. Results showed that the allelopathic potential of leaf and seed extracts of A. mexicana decreased the seed germination (until 66.66%), plumule length (93.94%-94.94%), and radicle length (96.68%- 96.96%) respectively for T. aestivum and H. vulgare with a rise in extract concentration. Moreover, it was observed that the A. mexicana seed extract is more allelopathically effective than leaf extract. Hence, it could be concluded that the seed and leaf aqueous extracts contain water-soluble allelochemicals, which could inhibit seed germination of T. aestivum and H. vulgare.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Triticum/growth & development/drug effects
*Germination/drug effects
*Hordeum/growth & development/drug effects
Saudi Arabia
*Plant Extracts/pharmacology
Seeds/growth & development/chemistry
Plant Leaves/chemistry
*Argemone/chemistry
*Introduced Species
RevDate: 2026-03-07
CmpDate: 2026-03-07
Evolutionary Dynamics at the Leading Edge of Biological Invasions.
Bulletin of mathematical biology, 88(4):.
Empirical evidence shows that evolution may take place during species' range expansion. Indeed, dispersal ability tends to be selected for at the leading edge of invasions, ultimately increasing a species' spreading speed. However, for organisms across many different taxa, higher dispersal comes at the cost of fitness, producing evolutionary trade-offs at the leading edge. Using reaction-diffusion equations and adaptive dynamics, we provide new insights on how such evolutionary processes take place. We show how evolution may drive phenotypes at the leading edge to maximize the asymptotic spreading speed, and we give conditions under which phenotypic plasticity in dispersal is selected for under different dispersal-reproduction trade-off scenarios. We provide some possible future research directions and other systems where the framework can be applied.
Additional Links: PMID-41779299
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41779299,
year = {2026},
author = {Poloni, S and Lutscher, F and Lewis, MA},
title = {Evolutionary Dynamics at the Leading Edge of Biological Invasions.},
journal = {Bulletin of mathematical biology},
volume = {88},
number = {4},
pages = {},
pmid = {41779299},
issn = {1522-9602},
support = {RGPIN-2024-05210//Natural Sciences and Engineering Research Council of Canada/ ; RGPIN-2023-03872//Natural Sciences and Engineering Research Council of Canada/ ; },
mesh = {*Biological Evolution ; Mathematical Concepts ; *Models, Biological ; *Introduced Species/statistics & numerical data ; Population Dynamics ; Animals ; Phenotype ; Ecosystem ; Genetic Fitness ; },
abstract = {Empirical evidence shows that evolution may take place during species' range expansion. Indeed, dispersal ability tends to be selected for at the leading edge of invasions, ultimately increasing a species' spreading speed. However, for organisms across many different taxa, higher dispersal comes at the cost of fitness, producing evolutionary trade-offs at the leading edge. Using reaction-diffusion equations and adaptive dynamics, we provide new insights on how such evolutionary processes take place. We show how evolution may drive phenotypes at the leading edge to maximize the asymptotic spreading speed, and we give conditions under which phenotypic plasticity in dispersal is selected for under different dispersal-reproduction trade-off scenarios. We provide some possible future research directions and other systems where the framework can be applied.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Biological Evolution
Mathematical Concepts
*Models, Biological
*Introduced Species/statistics & numerical data
Population Dynamics
Animals
Phenotype
Ecosystem
Genetic Fitness
RevDate: 2026-03-07
CmpDate: 2026-03-07
Investigating key drivers influencing AI-based detection and identification of plants.
PloS one, 21(3):e0342712.
In recent years, AI-driven platforms have transformed citizen science by collecting and generating valuable records of living organisms for monitoring biological data. Many applications utilize visual similarity and geospatial information to identify species based on photographs. This study investigates how location impacts plant identifications made by iNaturalist, particularly in detecting invasive alien plants (IAP) that are not established in an area. We also compare the accuracy of iNaturalist and PlantNet while exploring potential biases. To assess iNaturalist's taxonomic accuracy under varying location parameters, specimens of plants that are native and naturalized in Ontario, termed "established plants" for the purpose of this study, were collected and photographed (n = 61) and photographs of plants from Canada's regulated pest list, which are either not present or have a very limited distribution in Canada, termed "outsider plants" for the purpose of this study were exported from iNaturalist and GBIF (n = 402). We used photographs of the established plants to compare taxonomic accuracy between applications, considering factors such as plant families, distribution status, and visible parts. A scoring system was established, and a cumulative linked mixed model was applied to analyze taxonomic accuracy. Our findings reveal that restricting location significantly hinders iNaturalist's ability to identify IAP, highlighting the potential for missed detections. While sample size limitations prevented a robust comparison between applications, we also found significantly lower identification accuracy for species in the Poaceae family and for photographs featuring only leaves. Ultimately, recognizing the influence of location is essential for effectively monitoring IAP and leveraging iNaturalist as a tool for early detection.
Additional Links: PMID-41770734
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41770734,
year = {2026},
author = {Charron, A and Julien, A and Stinziano, JR and Gagnon, MC},
title = {Investigating key drivers influencing AI-based detection and identification of plants.},
journal = {PloS one},
volume = {21},
number = {3},
pages = {e0342712},
pmid = {41770734},
issn = {1932-6203},
mesh = {*Plants/classification ; *Introduced Species ; Ontario ; *Artificial Intelligence ; Photography ; },
abstract = {In recent years, AI-driven platforms have transformed citizen science by collecting and generating valuable records of living organisms for monitoring biological data. Many applications utilize visual similarity and geospatial information to identify species based on photographs. This study investigates how location impacts plant identifications made by iNaturalist, particularly in detecting invasive alien plants (IAP) that are not established in an area. We also compare the accuracy of iNaturalist and PlantNet while exploring potential biases. To assess iNaturalist's taxonomic accuracy under varying location parameters, specimens of plants that are native and naturalized in Ontario, termed "established plants" for the purpose of this study, were collected and photographed (n = 61) and photographs of plants from Canada's regulated pest list, which are either not present or have a very limited distribution in Canada, termed "outsider plants" for the purpose of this study were exported from iNaturalist and GBIF (n = 402). We used photographs of the established plants to compare taxonomic accuracy between applications, considering factors such as plant families, distribution status, and visible parts. A scoring system was established, and a cumulative linked mixed model was applied to analyze taxonomic accuracy. Our findings reveal that restricting location significantly hinders iNaturalist's ability to identify IAP, highlighting the potential for missed detections. While sample size limitations prevented a robust comparison between applications, we also found significantly lower identification accuracy for species in the Poaceae family and for photographs featuring only leaves. Ultimately, recognizing the influence of location is essential for effectively monitoring IAP and leveraging iNaturalist as a tool for early detection.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Plants/classification
*Introduced Species
Ontario
*Artificial Intelligence
Photography
RevDate: 2026-03-06
Competitive interactions during community assembly: how native species identity, diversity, and functional traits affect invasion.
Oecologia, 208(3):.
Competitive interactions during community assembly are critical for suppressing invasive species and restoring native biodiversity. However, the roles of plant community attributes in determining competitive suppression remain unclear. We examined the competitive suppression of the invasive perennial herb Solidago altissima L. through a two-year greenhouse experiment. To assess species identity effects, we established pairwise competitions between S. altissima and 19 native species. Diversity effects were evaluated by comparing invasion success in eight four-species native mixtures versus monocultures using relative competition indices (RCI) based on height, cover, density, and biomass. Species identity and functional groups were critical determinants of competitive outcomes. 14 native species significantly suppressed S. altissima growth, with annual herbs (RCI = 0.608-0.771) and perennial herbs (RCI = 0.471-0.666) providing the strongest suppression, while woody perennials were the least effective (RCI = 0.197-0.250). Species diversity showed marginally positive but non-significant effects. Competitive suppression of S. altissima was marginally stronger in mixtures than in monocultures by the second year (mixture RCI = 0.764, monoculture RCI = 0.531, P = 0.084). Functional traits showed inconsistent relationships with competitive outcomes, and trait similarity did not predict invasion suppression. Our results indicate that competitive suppression is primarily driven by species and functional group identities rather than by diversity or trait similarities. Restoration efforts should prioritize fast-growing, canopy-covering non-woody native annuals and perennials-particularly forbs with high specific leaf area, large seed mass, and early canopy dominance-to maximize competitive suppression during community assembly.
Additional Links: PMID-41790308
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41790308,
year = {2026},
author = {Jeong, D and Singh, K and Byun, C},
title = {Competitive interactions during community assembly: how native species identity, diversity, and functional traits affect invasion.},
journal = {Oecologia},
volume = {208},
number = {3},
pages = {},
pmid = {41790308},
issn = {1432-1939},
support = {2022R1A2C1003504//National Research Foundation of Korea/ ; B0080529001944//Ministry of Education/ ; },
abstract = {Competitive interactions during community assembly are critical for suppressing invasive species and restoring native biodiversity. However, the roles of plant community attributes in determining competitive suppression remain unclear. We examined the competitive suppression of the invasive perennial herb Solidago altissima L. through a two-year greenhouse experiment. To assess species identity effects, we established pairwise competitions between S. altissima and 19 native species. Diversity effects were evaluated by comparing invasion success in eight four-species native mixtures versus monocultures using relative competition indices (RCI) based on height, cover, density, and biomass. Species identity and functional groups were critical determinants of competitive outcomes. 14 native species significantly suppressed S. altissima growth, with annual herbs (RCI = 0.608-0.771) and perennial herbs (RCI = 0.471-0.666) providing the strongest suppression, while woody perennials were the least effective (RCI = 0.197-0.250). Species diversity showed marginally positive but non-significant effects. Competitive suppression of S. altissima was marginally stronger in mixtures than in monocultures by the second year (mixture RCI = 0.764, monoculture RCI = 0.531, P = 0.084). Functional traits showed inconsistent relationships with competitive outcomes, and trait similarity did not predict invasion suppression. Our results indicate that competitive suppression is primarily driven by species and functional group identities rather than by diversity or trait similarities. Restoration efforts should prioritize fast-growing, canopy-covering non-woody native annuals and perennials-particularly forbs with high specific leaf area, large seed mass, and early canopy dominance-to maximize competitive suppression during community assembly.},
}
RevDate: 2026-03-06
CmpDate: 2026-03-06
Phenotypic selection in weedy radish and its bidirectional crop-weed hybrids across two contrasting environments.
AoB PLANTS, 18(2):plag010.
Hybridization is a key mechanism in the adaptive evolution of weeds and invasive species. The evolutionary success of hybrids may be shaped by selection on functional traits, interacting with maternal genotype and ecological context. We performed experimental hybridization and common garden field experiments to assess phenotypic variation on functional traits, and the strength and direction of linear and quadratic selection acting on them, in bidirectional crop-weed hybrids and their parents of Raphanus sativus, across two contrasting environments: agrestal (agricultural) and ruderal (human-disturbed uncultivated area), over two years. Bidirectional hybrids exhibited overall greater values for size-related traits than their parents, with similar flowering time and no significant effects of cross direction. Selection acted on multiple functional traits through both linear and quadratic components, with broadly similar patterns across environments and cross types, although selection tended to be slightly stronger in hybrids than in weeds. Intraspecific crop-weed hybridization, regardless of cross direction, can increase weediness in weedy radish by enhancing plant size, thereby increasing competitive ability and potential interference with crops. Our findings highlight how hybridization and selection shape plant evolution, influencing the potential introgression of crop alleles into wild or weedy gene pools. Understanding the hybridization process and the mechanisms that control it is crucial for managing the evolutionary outcomes of crop-weed hybridization.
Additional Links: PMID-41788914
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41788914,
year = {2026},
author = {Vercellino, RB and Hernández, F and Tillería, S and Simian, D and Fanna, I and Presotto, A},
title = {Phenotypic selection in weedy radish and its bidirectional crop-weed hybrids across two contrasting environments.},
journal = {AoB PLANTS},
volume = {18},
number = {2},
pages = {plag010},
pmid = {41788914},
issn = {2041-2851},
abstract = {Hybridization is a key mechanism in the adaptive evolution of weeds and invasive species. The evolutionary success of hybrids may be shaped by selection on functional traits, interacting with maternal genotype and ecological context. We performed experimental hybridization and common garden field experiments to assess phenotypic variation on functional traits, and the strength and direction of linear and quadratic selection acting on them, in bidirectional crop-weed hybrids and their parents of Raphanus sativus, across two contrasting environments: agrestal (agricultural) and ruderal (human-disturbed uncultivated area), over two years. Bidirectional hybrids exhibited overall greater values for size-related traits than their parents, with similar flowering time and no significant effects of cross direction. Selection acted on multiple functional traits through both linear and quadratic components, with broadly similar patterns across environments and cross types, although selection tended to be slightly stronger in hybrids than in weeds. Intraspecific crop-weed hybridization, regardless of cross direction, can increase weediness in weedy radish by enhancing plant size, thereby increasing competitive ability and potential interference with crops. Our findings highlight how hybridization and selection shape plant evolution, influencing the potential introgression of crop alleles into wild or weedy gene pools. Understanding the hybridization process and the mechanisms that control it is crucial for managing the evolutionary outcomes of crop-weed hybridization.},
}
RevDate: 2026-03-05
CmpDate: 2026-03-05
Marsh Interspersion and Muskrat (Ondatra zibethicus) Habitat Use.
Ecology and evolution, 16(3):e73155.
Muskrat (Ondatra zibethicus) populations have been declining in North America for decades. The precise cause of these widespread declines has not yet been identified. Over a similar timeframe, wetlands across large regions of North America have been experiencing an invasion of hybrid cattail Typha x glauca. This invasion is associated with many negative consequences for wetlands, including a reduction in biodiversity, open water habitat, and interspersion of water and vegetation. Muskrats are strongly tied to wetlands, especially where there is a high degree of interspersion of water and emergent vegetation. Therefore, a widespread reduction in interspersion caused by T. x glauca invasions may be contributing to widespread muskrat population declines. We sought to better understand the impact of marsh interspersion on fine-scale muskrat habitat use in light of widespread invasions of T. x glauca. We measured intensity of habitat use by muskrats in a large, Typha-dominated marsh in south-central Ontario using camera traps, stratifying camera placement along a gradient of interspersion. We found no correlation between interspersion and intensity of use. The ubiquity of T. x glauca and low overall interspersion at our study site may have prevented a robust test of our hypothesis. Further research is needed to determine precisely how interspersion affects muskrat habitat use at a fine scale, and how potential changes in habitat quality and use may be contributing to widespread muskrat population declines.
Additional Links: PMID-41783353
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41783353,
year = {2026},
author = {Melvin, GP and Bowman, J},
title = {Marsh Interspersion and Muskrat (Ondatra zibethicus) Habitat Use.},
journal = {Ecology and evolution},
volume = {16},
number = {3},
pages = {e73155},
pmid = {41783353},
issn = {2045-7758},
abstract = {Muskrat (Ondatra zibethicus) populations have been declining in North America for decades. The precise cause of these widespread declines has not yet been identified. Over a similar timeframe, wetlands across large regions of North America have been experiencing an invasion of hybrid cattail Typha x glauca. This invasion is associated with many negative consequences for wetlands, including a reduction in biodiversity, open water habitat, and interspersion of water and vegetation. Muskrats are strongly tied to wetlands, especially where there is a high degree of interspersion of water and emergent vegetation. Therefore, a widespread reduction in interspersion caused by T. x glauca invasions may be contributing to widespread muskrat population declines. We sought to better understand the impact of marsh interspersion on fine-scale muskrat habitat use in light of widespread invasions of T. x glauca. We measured intensity of habitat use by muskrats in a large, Typha-dominated marsh in south-central Ontario using camera traps, stratifying camera placement along a gradient of interspersion. We found no correlation between interspersion and intensity of use. The ubiquity of T. x glauca and low overall interspersion at our study site may have prevented a robust test of our hypothesis. Further research is needed to determine precisely how interspersion affects muskrat habitat use at a fine scale, and how potential changes in habitat quality and use may be contributing to widespread muskrat population declines.},
}
RevDate: 2026-03-06
CmpDate: 2026-03-06
Nucleolar dominance arises in Spartina homoploid hybrids and persists after allopolyploidization.
The Plant journal : for cell and molecular biology, 125(5):e70770.
Allopolyploid Spartina anglica C.E. Hubbard (2n = 120-124) has become recognized as a model system of recent allopolyploid speciation. It arose by interspecific hybridization between S. alterniflora (2n = 62) introduced from North America and the native European S. maritima (2n = 60) about 150 years ago. In addition, sterile first-generation homoploid hybrids S. × townsendii and S. × neyrautii (both 2n = 62) are still extant. In this study, we carried out a population-level study of epigenetic silencing of 35S rDNA loci, also known as nucleolar dominance. Using molecular, genomic, and cytogenetic methods, we analyzed 75 individuals of S. anglica (collected from 11 French populations and 5 UK populations), 34 individuals of S. × townsendii (3 populations, all from the UK), and 2 individuals of S. × neyrautii from the south of France. We observed strong transcriptional dominance of S. alterniflora-inherited rDNA in all hybrid and allopolyploid individuals. The dominant rDNA units were nearly devoid of methylation at CWG sites, in contrast to those of the silenced S. maritima-inherited rDNA (M-loci), which exhibited hypermethylation. At the DNA level, few (2%) S. anglica individuals have completely lost M-loci, indicating that rDNA diploidization proceeds extremely fast in Spartina, and such a process may be influenced by preceding epigenetic processes. We conclude that nucleolar dominance is already present in extant homoploid hybrid lineages and is largely maintained in S. anglica, with occasional partial relaxation.
Additional Links: PMID-41782262
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41782262,
year = {2026},
author = {Kuderová, A and Húska, D and de Carvalho, JF and Matyášek, R and Leitch, IJ and Salmon, A and Leitch, AR and Ainouche, M and Kovařík, A},
title = {Nucleolar dominance arises in Spartina homoploid hybrids and persists after allopolyploidization.},
journal = {The Plant journal : for cell and molecular biology},
volume = {125},
number = {5},
pages = {e70770},
pmid = {41782262},
issn = {1365-313X},
support = {25-16796S//Grantová Agentura České Republiky/ ; //Centre National de la Recherche Scientifique/ ; //Natural Environment Research Council/ ; },
mesh = {*Polyploidy ; Hybridization, Genetic ; DNA, Ribosomal/genetics ; *Poaceae/genetics ; *Cell Nucleolus/genetics ; France ; DNA Methylation ; DNA, Plant/genetics ; },
abstract = {Allopolyploid Spartina anglica C.E. Hubbard (2n = 120-124) has become recognized as a model system of recent allopolyploid speciation. It arose by interspecific hybridization between S. alterniflora (2n = 62) introduced from North America and the native European S. maritima (2n = 60) about 150 years ago. In addition, sterile first-generation homoploid hybrids S. × townsendii and S. × neyrautii (both 2n = 62) are still extant. In this study, we carried out a population-level study of epigenetic silencing of 35S rDNA loci, also known as nucleolar dominance. Using molecular, genomic, and cytogenetic methods, we analyzed 75 individuals of S. anglica (collected from 11 French populations and 5 UK populations), 34 individuals of S. × townsendii (3 populations, all from the UK), and 2 individuals of S. × neyrautii from the south of France. We observed strong transcriptional dominance of S. alterniflora-inherited rDNA in all hybrid and allopolyploid individuals. The dominant rDNA units were nearly devoid of methylation at CWG sites, in contrast to those of the silenced S. maritima-inherited rDNA (M-loci), which exhibited hypermethylation. At the DNA level, few (2%) S. anglica individuals have completely lost M-loci, indicating that rDNA diploidization proceeds extremely fast in Spartina, and such a process may be influenced by preceding epigenetic processes. We conclude that nucleolar dominance is already present in extant homoploid hybrid lineages and is largely maintained in S. anglica, with occasional partial relaxation.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Polyploidy
Hybridization, Genetic
DNA, Ribosomal/genetics
*Poaceae/genetics
*Cell Nucleolus/genetics
France
DNA Methylation
DNA, Plant/genetics
RevDate: 2026-03-06
CmpDate: 2026-03-06
[Identification and evaluation of cold source risk organisms in close areas of a coastal nuclear power plant].
Ying yong sheng tai xue bao = The journal of applied ecology, 37(2):551-562.
Species invasion in marine has increased the frequency of security incidents at coastal nuclear power plants, posing serious threats to the cooling water intake. To systematically identify the risk organisms in nuclear power cooling water sources and clarify their distribution pattern, we established a risk identification and assessment framework for marine organisms in cooling water intake areas. Based on field investigation conducted in the summer of 2024 in the adjacent waters of a nuclear power plant in northern China, we categorized marine organisms into five types: phytoplankton, zooplankton, swimming animals, benthic animals, and selected intertidal organisms. Trophic level, habitat layer, body size, body length, and density were used as evaluation criteria. These indices were combined with type-specific traits (e.g., migratory behavior and reproduction mode) to develop a scoring system, with each indicator being assigned a maximum score of 10 points. Scores were determined based on the potential risk of each biological trait to clogging the water intake, and a spatial weight based on the distance from sampling points to the intake was incorporated to calculate the total risk score for each species. We classified risk levels into low, medium, and high according to thresholds set at 30% and 80% of the total possible score. Results showed that a total of 40 phytoplankton, 28 zooplankton, 27 swimming animals, 62 benthic animals, and 43 intertidal species were recorded. Through multi-indicator integration and spatial weighting analysis-balancing field data authenticity and theoretical traits of species, Loligo sp., Charybdis japonica, and Konosirus punctatus were identified as high-risk species. Moreover, there was a higher density of high-risk organisms in the northern area near the water intake. By integrating functional traits and measured data into a comprehensive evaluation framework, this study could provide a scientific basis for risk organism identification, early warning, and the development of prevention and control strategies for cooling water systems near nuclear power plants.
Additional Links: PMID-41777209
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41777209,
year = {2026},
author = {Hu, XY and Cui, M and Jin, Y and Liu, GZ and Song, CC and Zhang, YL},
title = {[Identification and evaluation of cold source risk organisms in close areas of a coastal nuclear power plant].},
journal = {Ying yong sheng tai xue bao = The journal of applied ecology},
volume = {37},
number = {2},
pages = {551-562},
doi = {10.13287/j.1001-9332.202602.031},
pmid = {41777209},
issn = {1001-9332},
mesh = {Animals ; *Nuclear Power Plants ; China ; *Ecosystem ; Phytoplankton/growth & development ; *Aquatic Organisms/growth & development/classification ; *Environmental Monitoring/methods ; Risk Assessment ; Zooplankton/growth & development ; *Introduced Species ; Cold Temperature ; Oceans and Seas ; },
abstract = {Species invasion in marine has increased the frequency of security incidents at coastal nuclear power plants, posing serious threats to the cooling water intake. To systematically identify the risk organisms in nuclear power cooling water sources and clarify their distribution pattern, we established a risk identification and assessment framework for marine organisms in cooling water intake areas. Based on field investigation conducted in the summer of 2024 in the adjacent waters of a nuclear power plant in northern China, we categorized marine organisms into five types: phytoplankton, zooplankton, swimming animals, benthic animals, and selected intertidal organisms. Trophic level, habitat layer, body size, body length, and density were used as evaluation criteria. These indices were combined with type-specific traits (e.g., migratory behavior and reproduction mode) to develop a scoring system, with each indicator being assigned a maximum score of 10 points. Scores were determined based on the potential risk of each biological trait to clogging the water intake, and a spatial weight based on the distance from sampling points to the intake was incorporated to calculate the total risk score for each species. We classified risk levels into low, medium, and high according to thresholds set at 30% and 80% of the total possible score. Results showed that a total of 40 phytoplankton, 28 zooplankton, 27 swimming animals, 62 benthic animals, and 43 intertidal species were recorded. Through multi-indicator integration and spatial weighting analysis-balancing field data authenticity and theoretical traits of species, Loligo sp., Charybdis japonica, and Konosirus punctatus were identified as high-risk species. Moreover, there was a higher density of high-risk organisms in the northern area near the water intake. By integrating functional traits and measured data into a comprehensive evaluation framework, this study could provide a scientific basis for risk organism identification, early warning, and the development of prevention and control strategies for cooling water systems near nuclear power plants.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Nuclear Power Plants
China
*Ecosystem
Phytoplankton/growth & development
*Aquatic Organisms/growth & development/classification
*Environmental Monitoring/methods
Risk Assessment
Zooplankton/growth & development
*Introduced Species
Cold Temperature
Oceans and Seas
RevDate: 2026-03-06
CmpDate: 2026-03-06
Surviving the Squeeze: Genomic Analysis of a Successful Invasion by European Common Wall Lizards (Podarcis muralis) in North America (Ohio, USA).
Molecular ecology, 35(5):e70288.
Invasive species that undergo a founder event may experience a decline in genetic diversity yet still establish successful populations. A possible example is a population of the common wall lizard (Podarcis muralis) in Cincinnati, Ohio, USA, which was founded following an introduction in the 1950s of a small number of individuals from Europe. We used whole genome sequences of individuals from source and introduced populations to assess the origin, demographic history, population structure, and possible signatures of adaptation in this successful lizard introduction. We first confirmed that the introduced lizards in Ohio are Podarcis muralis using phylogenetic analysis. Patterns of genetic diversity indicate introduced lizards in Cincinnati went through a short-term bottleneck with increased inbreeding but then rapidly increased in population size, thus minimising losses in genetic diversity. Comparisons of genomic variation between source and introduced populations demonstrate that populations in Cincinnati represent a subset of source genetic variation and show minimal losses of overall genetic diversity. Comparisons of mutation load between source and introduced populations reveal only small increases in load in introduced populations. Finally, tests for selection on the basis of outlier analyses detect targets for potential positive selection in multiple regions of the genome of introduced individuals, suggesting possible adaptation to a novel environment. Overall, we suggest that rapid population growth and possible adaptation have allowed the founding population of introduced lizards to evade the potential negative genetic impacts of small population size and successfully colonise a novel environment.
Additional Links: PMID-41776974
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41776974,
year = {2026},
author = {Bode, ER and Mason, AJ and Bolton, PE and Petren, K and Gangloff, EJ and Gibbs, HL},
title = {Surviving the Squeeze: Genomic Analysis of a Successful Invasion by European Common Wall Lizards (Podarcis muralis) in North America (Ohio, USA).},
journal = {Molecular ecology},
volume = {35},
number = {5},
pages = {e70288},
pmid = {41776974},
issn = {1365-294X},
support = {2217826//National Science Foundation BRC-BIO Award No/ ; },
mesh = {Animals ; *Lizards/genetics ; *Introduced Species ; *Genetic Variation ; Phylogeny ; *Genetics, Population ; Ohio ; Genomics ; Population Density ; Europe ; },
abstract = {Invasive species that undergo a founder event may experience a decline in genetic diversity yet still establish successful populations. A possible example is a population of the common wall lizard (Podarcis muralis) in Cincinnati, Ohio, USA, which was founded following an introduction in the 1950s of a small number of individuals from Europe. We used whole genome sequences of individuals from source and introduced populations to assess the origin, demographic history, population structure, and possible signatures of adaptation in this successful lizard introduction. We first confirmed that the introduced lizards in Ohio are Podarcis muralis using phylogenetic analysis. Patterns of genetic diversity indicate introduced lizards in Cincinnati went through a short-term bottleneck with increased inbreeding but then rapidly increased in population size, thus minimising losses in genetic diversity. Comparisons of genomic variation between source and introduced populations demonstrate that populations in Cincinnati represent a subset of source genetic variation and show minimal losses of overall genetic diversity. Comparisons of mutation load between source and introduced populations reveal only small increases in load in introduced populations. Finally, tests for selection on the basis of outlier analyses detect targets for potential positive selection in multiple regions of the genome of introduced individuals, suggesting possible adaptation to a novel environment. Overall, we suggest that rapid population growth and possible adaptation have allowed the founding population of introduced lizards to evade the potential negative genetic impacts of small population size and successfully colonise a novel environment.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Lizards/genetics
*Introduced Species
*Genetic Variation
Phylogeny
*Genetics, Population
Ohio
Genomics
Population Density
Europe
RevDate: 2026-03-04
Environmental DNA metabarcoding facilitates integrative conservation assessments and species rediscoveries in tropical biodiversity hotspots.
Scientific reports, 16(1):.
UNLABELLED: Environmental DNA (eDNA) metabarcoding is an emerging and versatile tool in biodiversity research. With recent advances in field sampling techniques, this approach becomes increasingly suited for application in tropical ecosystems where biodiversity monitoring gaps remain significant and species detection is particularly challenging. Using amphibians as a model, we harness eDNA metabarcoding in 52 localities in the Tropical Andean biodiversity hotspot to rapidly trace elusive, threatened, or presumed extinct species as a baseline for conservation action. Metabarcoding ‘bycatch’ of non-target species further revealed specific environmental threats through the detection of invasive species and pathogens, thus facilitating integrative conservation assessments despite the incompleteness of reference data and the vast species richness hampering biodiversity assessments in complex tropical communities. Consequently, we call for more intense employment of eDNA metabarcoding in conservation to rapidly bridge critical knowledge gaps on elusive species or declining populations in tropical biodiversity hotspots.
SUPPLEMENTARY INFORMATION: The online version contains supplementary material available at 10.1038/s41598-026-41937-x.
Additional Links: PMID-41775849
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41775849,
year = {2026},
author = {Plewnia, A and Hildwein, T and Quezada Riera, AB and Terán-Valdez, A and Crawford, AJ and Heine, C and Franco-Mena, D and Székely, D and Armijos-Ojeda, D and Siavichay, FR and Arpi, JD and Salazar, J and Erens, J and Páez-Vacas, MI and Székely, P and Böning, P and Stassen, R and Carvajal-Endara, S and Lötters, S and Guayasamin, JM},
title = {Environmental DNA metabarcoding facilitates integrative conservation assessments and species rediscoveries in tropical biodiversity hotspots.},
journal = {Scientific reports},
volume = {16},
number = {1},
pages = {},
pmid = {41775849},
issn = {2045-2322},
abstract = {UNLABELLED: Environmental DNA (eDNA) metabarcoding is an emerging and versatile tool in biodiversity research. With recent advances in field sampling techniques, this approach becomes increasingly suited for application in tropical ecosystems where biodiversity monitoring gaps remain significant and species detection is particularly challenging. Using amphibians as a model, we harness eDNA metabarcoding in 52 localities in the Tropical Andean biodiversity hotspot to rapidly trace elusive, threatened, or presumed extinct species as a baseline for conservation action. Metabarcoding ‘bycatch’ of non-target species further revealed specific environmental threats through the detection of invasive species and pathogens, thus facilitating integrative conservation assessments despite the incompleteness of reference data and the vast species richness hampering biodiversity assessments in complex tropical communities. Consequently, we call for more intense employment of eDNA metabarcoding in conservation to rapidly bridge critical knowledge gaps on elusive species or declining populations in tropical biodiversity hotspots.
SUPPLEMENTARY INFORMATION: The online version contains supplementary material available at 10.1038/s41598-026-41937-x.},
}
RevDate: 2026-03-03
Metagenomic and gene expression patterns in declining commercial honey bee colonies.
Scientific reports pii:10.1038/s41598-026-42605-w [Epub ahead of print].
Additional Links: PMID-41775798
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41775798,
year = {2026},
author = {Nearman, A and Lamas, ZS and Niño, EL and Fine, J and Mayack, C and Seshadri, A and Boncristiani, D and Huang, WF and Evans, JD and Chen, YP},
title = {Metagenomic and gene expression patterns in declining commercial honey bee colonies.},
journal = {Scientific reports},
volume = {},
number = {},
pages = {},
doi = {10.1038/s41598-026-42605-w},
pmid = {41775798},
issn = {2045-2322},
support = {FSA25IRA0012292//Farm Service Agency/ ; 8130-0960//Animal and Plant Health Inspection Service/ ; },
}
RevDate: 2026-03-03
Integrative omics approaches reveal mechanisms of combined heat stress and extreme hypoxia tolerance in a Cerambycid beetle larva.
The Journal of experimental biology pii:370919 [Epub ahead of print].
Atmospheric oxygen, which is essential for energy metabolism, can directly influence an animal's heat tolerance by affecting oxygen transport processes, especially in those living in oxygen-poor environments such as plant tissues, underground or aquatic environments. Yet, oxygen availability and heat tolerance are rarely studied together, limiting our ability to predict their combined effects on insect performance. This study examines the larval tolerance of a large xylophagous cerambycid beetle Cacosceles newmannii to combined hypoxic and thermal stress using performance assays (duration of righting response) coupled with metabolomic and transcriptomic analyses. Metabolomic profiling showed that most metabolites were downregulated in the body but upregulated in the haemolymph as stress increased. Transcriptomic profiles clustered primarily by temperature (25 °C vs 35 °C), independent of oxygen level. Cacosceles newmannii appeared capable of modulating its performance to reduce the energy costs and physiological damage induced by hypoxia. This suggested a high baseline hypoxia tolerance rather than a rapid plastic (induced) physiological hypoxia response, probably due to the species' endophytic lifestyle. Conversely, thermal stress led to a predictable increase in metabolic activity but did not markedly affect performance, triggering adjustments to maintain cellular functions while limiting the impact of stresses expected under conditions of high temperature, such as desiccation. In short, our study highlights the distinct metabolic pathways mobilised to cope with hypoxic versus thermal stress, emphasizing the importance of integrated approaches in understanding insect responses to environmental challenges. These findings have significant implications for understanding the species' ecology, with applications for pest management and sustainable agriculture in the context of climate change.
Additional Links: PMID-41772970
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41772970,
year = {2026},
author = {Javal, M and Lehmann, P and Bierman, A and Koštál, V and Moos, M and Smit, C and Vogel, H and Conlong, DE and Terblanche, JS},
title = {Integrative omics approaches reveal mechanisms of combined heat stress and extreme hypoxia tolerance in a Cerambycid beetle larva.},
journal = {The Journal of experimental biology},
volume = {},
number = {},
pages = {},
doi = {10.1242/jeb.251552},
pmid = {41772970},
issn = {1477-9145},
abstract = {Atmospheric oxygen, which is essential for energy metabolism, can directly influence an animal's heat tolerance by affecting oxygen transport processes, especially in those living in oxygen-poor environments such as plant tissues, underground or aquatic environments. Yet, oxygen availability and heat tolerance are rarely studied together, limiting our ability to predict their combined effects on insect performance. This study examines the larval tolerance of a large xylophagous cerambycid beetle Cacosceles newmannii to combined hypoxic and thermal stress using performance assays (duration of righting response) coupled with metabolomic and transcriptomic analyses. Metabolomic profiling showed that most metabolites were downregulated in the body but upregulated in the haemolymph as stress increased. Transcriptomic profiles clustered primarily by temperature (25 °C vs 35 °C), independent of oxygen level. Cacosceles newmannii appeared capable of modulating its performance to reduce the energy costs and physiological damage induced by hypoxia. This suggested a high baseline hypoxia tolerance rather than a rapid plastic (induced) physiological hypoxia response, probably due to the species' endophytic lifestyle. Conversely, thermal stress led to a predictable increase in metabolic activity but did not markedly affect performance, triggering adjustments to maintain cellular functions while limiting the impact of stresses expected under conditions of high temperature, such as desiccation. In short, our study highlights the distinct metabolic pathways mobilised to cope with hypoxic versus thermal stress, emphasizing the importance of integrated approaches in understanding insect responses to environmental challenges. These findings have significant implications for understanding the species' ecology, with applications for pest management and sustainable agriculture in the context of climate change.},
}
RevDate: 2026-03-06
CmpDate: 2026-03-06
Does Increasing Atmospheric Carbon Dioxide Facilitate Plant Invasions?.
Global change biology, 32(3):e70757.
Elevated CO2 alters resource allocation, which should benefit species that produce metabolically expensive specialized metabolites (in orange). Increasing biochemical production will have consequences for plant competition, plant-soil feedbacks, and ecosystem processes, and can create fitness advantages for these species over species that do not produce these chemicals (in black).
Additional Links: PMID-41772881
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41772881,
year = {2026},
author = {Cadotte, MW and Inderjit, and Turner, SC and Midgley, GF},
title = {Does Increasing Atmospheric Carbon Dioxide Facilitate Plant Invasions?.},
journal = {Global change biology},
volume = {32},
number = {3},
pages = {e70757},
pmid = {41772881},
issn = {1365-2486},
support = {386151//Natural Sciences and Engineering Research Council of Canada/ ; },
mesh = {*Carbon Dioxide/analysis/metabolism ; *Introduced Species ; *Atmosphere/chemistry ; Ecosystem ; *Plants/metabolism ; Climate Change ; },
abstract = {Elevated CO2 alters resource allocation, which should benefit species that produce metabolically expensive specialized metabolites (in orange). Increasing biochemical production will have consequences for plant competition, plant-soil feedbacks, and ecosystem processes, and can create fitness advantages for these species over species that do not produce these chemicals (in black).},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Carbon Dioxide/analysis/metabolism
*Introduced Species
*Atmosphere/chemistry
Ecosystem
*Plants/metabolism
Climate Change
RevDate: 2026-03-02
CmpDate: 2026-03-02
Predicting current and future distributions of bird species in South Africa's arid Northern Cape under climate change scenarios: are biomes being crossed?.
Biodiversity data journal, 14:e177882.
Climate change involves rising temperatures and altered precipitation patterns which lead to the contraction, expansion or shift in the ranges of biodiversity. This study employed MaxEnt to predict current and future distributions of three bird species native to South Africa and one invasive species. Future scenarios were modelled for 2050 and 2070 using three pathways: SSP1-2.6, SSP2-4.5 and SSP5-8.5 and four bioclimatic variables. The models showed good performance, with AUC values above 0.7, indicating high predictive accuracy. Comparisons between current ranges and future predictions show species, such as P. purpureus and L. torquatus, moving south-westwards and crossing into new biomes in response to changing climatic conditions. Meanwhile, U. angolensis shows drastic range contraction, with A. tristis showing expansion into arid environments. Across all concentration pathways, for both time periods, all species show expansion into southern arid regions of the Northern Cape. The models suggest that bird species are not only moving to different geographic areas, but are also likely to cross biome boundaries, which may have ecological implications. The study highlights how climate change is a significant driver of changes in bird species distributions and their entry into new biomes. These findings underline the importance of adaptive conservation strategies that consider the dynamic nature of species distributions under climate change.
Additional Links: PMID-41768605
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41768605,
year = {2026},
author = {Appalasamy, M and Parker-Allie, F and Harebottle, DM},
title = {Predicting current and future distributions of bird species in South Africa's arid Northern Cape under climate change scenarios: are biomes being crossed?.},
journal = {Biodiversity data journal},
volume = {14},
number = {},
pages = {e177882},
pmid = {41768605},
issn = {1314-2828},
abstract = {Climate change involves rising temperatures and altered precipitation patterns which lead to the contraction, expansion or shift in the ranges of biodiversity. This study employed MaxEnt to predict current and future distributions of three bird species native to South Africa and one invasive species. Future scenarios were modelled for 2050 and 2070 using three pathways: SSP1-2.6, SSP2-4.5 and SSP5-8.5 and four bioclimatic variables. The models showed good performance, with AUC values above 0.7, indicating high predictive accuracy. Comparisons between current ranges and future predictions show species, such as P. purpureus and L. torquatus, moving south-westwards and crossing into new biomes in response to changing climatic conditions. Meanwhile, U. angolensis shows drastic range contraction, with A. tristis showing expansion into arid environments. Across all concentration pathways, for both time periods, all species show expansion into southern arid regions of the Northern Cape. The models suggest that bird species are not only moving to different geographic areas, but are also likely to cross biome boundaries, which may have ecological implications. The study highlights how climate change is a significant driver of changes in bird species distributions and their entry into new biomes. These findings underline the importance of adaptive conservation strategies that consider the dynamic nature of species distributions under climate change.},
}
RevDate: 2026-03-02
CmpDate: 2026-03-02
The complete chloroplast genome sequence and phylogenetic analysis of an invasive plant Solanum carolinense Linnaeus (Solanaceae) in Korea.
Mitochondrial DNA. Part B, Resources, 11(4):451-456.
Solanum carolinense Linnaeus, belonging to the family Solanaceae, is a perennial herb or subshrub. S. carolinense has become naturalized in Korea as an invasive species, forming a stable population that has grown naturally with native plants for more than 10 years. However, its chloroplast genome structure and complete sequence have not yet been reported. Therefore, we determined the complete chloroplast genome sequence of S. carolinense using genome sequencing, assembly, and annotation. The total length of the chloroplast genome was 155,315 bp with a GC content of 37.6%. It featured a quadripartite structure (a large single-copy region, 86,160 bp; a small single-copy region, 18,459 bp; and two inverted repeat regions, 25,348 bp each). It contains 129 genes, including 84 coding sequences (CDSs), 37 tRNA genes, 8 rRNA genes, and one pseudogene. Phylogenetic analysis of 78 CDSs revealed that S. carolinense is closely related to S. aridum Morong and S. hieronymi Kuntze. These results provide a molecular foundation for phylogenetic and evolutionary studies of the genus Solanum and present a fundamental chloroplast genomic resource for future invasion biology research.
Additional Links: PMID-41767882
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41767882,
year = {2026},
author = {Kim, HB and Jang, JE and Son, DC and Kang, ES},
title = {The complete chloroplast genome sequence and phylogenetic analysis of an invasive plant Solanum carolinense Linnaeus (Solanaceae) in Korea.},
journal = {Mitochondrial DNA. Part B, Resources},
volume = {11},
number = {4},
pages = {451-456},
pmid = {41767882},
issn = {2380-2359},
abstract = {Solanum carolinense Linnaeus, belonging to the family Solanaceae, is a perennial herb or subshrub. S. carolinense has become naturalized in Korea as an invasive species, forming a stable population that has grown naturally with native plants for more than 10 years. However, its chloroplast genome structure and complete sequence have not yet been reported. Therefore, we determined the complete chloroplast genome sequence of S. carolinense using genome sequencing, assembly, and annotation. The total length of the chloroplast genome was 155,315 bp with a GC content of 37.6%. It featured a quadripartite structure (a large single-copy region, 86,160 bp; a small single-copy region, 18,459 bp; and two inverted repeat regions, 25,348 bp each). It contains 129 genes, including 84 coding sequences (CDSs), 37 tRNA genes, 8 rRNA genes, and one pseudogene. Phylogenetic analysis of 78 CDSs revealed that S. carolinense is closely related to S. aridum Morong and S. hieronymi Kuntze. These results provide a molecular foundation for phylogenetic and evolutionary studies of the genus Solanum and present a fundamental chloroplast genomic resource for future invasion biology research.},
}
▼ ▼ LOAD NEXT 100 CITATIONS
ESP Quick Facts
ESP Origins
In the early 1990's, Robert Robbins was a faculty member at Johns Hopkins, where he directed the informatics core of GDB — the human gene-mapping database of the international human genome project. To share papers with colleagues around the world, he set up a small paper-sharing section on his personal web page. This small project evolved into The Electronic Scholarly Publishing Project.
ESP Support
In 1995, Robbins became the VP/IT of the Fred Hutchinson Cancer Research Center in Seattle, WA. Soon after arriving in Seattle, Robbins secured funding, through the ELSI component of the US Human Genome Project, to create the original ESP.ORG web site, with the formal goal of providing free, world-wide access to the literature of classical genetics.
ESP Rationale
Although the methods of molecular biology can seem almost magical to the uninitiated, the original techniques of classical genetics are readily appreciated by one and all: cross individuals that differ in some inherited trait, collect all of the progeny, score their attributes, and propose mechanisms to explain the patterns of inheritance observed.
ESP Goal
In reading the early works of classical genetics, one is drawn, almost inexorably, into ever more complex models, until molecular explanations begin to seem both necessary and natural. At that point, the tools for understanding genome research are at hand. Assisting readers reach this point was the original goal of The Electronic Scholarly Publishing Project.
ESP Usage
Usage of the site grew rapidly and has remained high. Faculty began to use the site for their assigned readings. Other on-line publishers, ranging from The New York Times to Nature referenced ESP materials in their own publications. Nobel laureates (e.g., Joshua Lederberg) regularly used the site and even wrote to suggest changes and improvements.
ESP Content
When the site began, no journals were making their early content available in digital format. As a result, ESP was obliged to digitize classic literature before it could be made available. For many important papers — such as Mendel's original paper or the first genetic map — ESP had to produce entirely new typeset versions of the works, if they were to be available in a high-quality format.
ESP Help
Early support from the DOE component of the Human Genome Project was critically important for getting the ESP project on a firm foundation. Since that funding ended (nearly 20 years ago), the project has been operated as a purely volunteer effort. Anyone wishing to assist in these efforts should send an email to Robbins.
ESP Plans
With the development of methods for adding typeset side notes to PDF files, the ESP project now plans to add annotated versions of some classical papers to its holdings. We also plan to add new reference and pedagogical material. We have already started providing regularly updated, comprehensive bibliographies to the ESP.ORG site.
ESP Picks from Around the Web (updated 28 JUL 2024 )
Old Science
Weird Science
Treating Disease with Fecal Transplantation
Fossils of miniature humans (hobbits) discovered in Indonesia
Paleontology
Dinosaur tail, complete with feathers, found preserved in amber.
Astronomy
Mysterious fast radio burst (FRB) detected in the distant universe.
Big Data & Informatics
Big Data: Buzzword or Big Deal?
Hacking the genome: Identifying anonymized human subjects using publicly available data.