Viewport Size Code:
Login | Create New Account
picture

  MENU

About | Classical Genetics | Timelines | What's New | What's Hot

About | Classical Genetics | Timelines | What's New | What's Hot

icon

Bibliography Options Menu

icon
QUERY RUN:
HITS:
PAGE OPTIONS:
Hide Abstracts   |   Hide Additional Links
NOTE:
Long bibliographies are displayed in blocks of 100 citations at a time. At the end of each block there is an option to load the next block.

Bibliography on: CRISPR-Cas

The Electronic Scholarly Publishing Project: Providing world-wide, free access to classic scientific papers and other scholarly materials, since 1993.

More About:  ESP | OUR CONTENT | THIS WEBSITE | WHAT'S NEW | WHAT'S HOT

ESP: PubMed Auto Bibliography 20 Oct 2018 at 01:34 Created: 

CRISPR-Cas

Clustered regularly interspaced short palindromic repeats (CRISPR, pronounced crisper) are segments of prokaryotic DNA containing short repetitions of base sequences. Each repetition is followed by short segments of "spacer DNA" from previous exposures to foreign DNA (e.g a virus or plasmid). The CRISPR/Cas system is a prokaryotic immune system that confers resistance to foreign genetic elements such as those present within plasmids and phages, and provides a form of acquired immunity. CRISPR associated proteins (Cas) use the CRISPR spacers to recognize and cut these exogenous genetic elements in a manner analogous to RNA interference in eukaryotic organisms. CRISPRs are found in approximately 40% of sequenced bacterial genomes and 90% of sequenced archaea. By delivering the Cas9 nuclease complexed with a synthetic guide RNA (gRNA) into a cell, the cell's genome can be cut at a desired location, allowing existing genes to be removed and/or new ones added. The Cas9-gRNA complex corresponds with the CAS III crRNA complex in the above diagram. CRISPR/Cas genome editing techniques have many potential applications, including altering the germline of humans, animals, and food crops. The use of CRISPR Cas9-gRNA complex for genome editing was the AAAS's choice for breakthrough of the year in 2015.

Created with PubMed® Query: "CRISPR.CAS" OR "crispr/cas" NOT pmcbook NOT ispreviousversion

Citations The Papers (from PubMed®)

RevDate: 2018-10-19

Zhou L, Peng R, Zhang R, et al (2018)

The applications of CRISPR/Cas system in molecular detection.

Journal of cellular and molecular medicine [Epub ahead of print].

The Streptococcus pyogenes CRISPR/Cas system has found widespread applications as a gene-editing and regulatory tool for the simultaneous delivery of the Cas9 protein and guide RNAs into the cell, thus making the recognition of specific DNA sequences possible. The recent study that shows that Cas9 can also bind to and cleave RNA in an RNA-programmable manner is suggestive of potential utility of this system as a universal nucleic-acid recognition tool. To increase the signal intensity of the CRISPR/Cas system, a signal amplification technique has to be exploited appropriately; this requirement is also a challenge for the detection of DNA or RNA. Furthermore, the CRISPR/Cas system may be used to detect point mutations or single-nucleotide variants because of the specificity of the recognition between the target sequence and the CRISPR/Cas system. These lines of evidence make this technique capable of detecting pathogens during infection via analysis of their DNA or RNA. Thus, here we summarize applications of the CRISPR/Cas system to the recognition and detection of DNA and RNA molecules as well as the signal amplification. We also describe its potential ability to detect mutations and single-nucleotide variants. Finally, we sum up its applications to testing for pathogens and potential barriers for its implementation.

RevDate: 2018-10-19

Parise D, Parise MTD, Viana MVC, et al (2018)

First genome sequencing and comparative analyses of Corynebacterium pseudotuberculosis strains from Mexico.

Standards in genomic sciences, 13:21 pii:325.

Corynebacterium pseudotuberculosis is a pathogenic bacterium which has been rapidly spreading all over the world, causing economic losses in the agricultural sector and sporadically infecting humans. Six C. pseudotuberculosis strains were isolated from goats, sheep, and horses with distinct abscess locations. For the first time, Mexican genomes of this bacterium were sequenced and studied in silico. All strains were sequenced using Ion Personal Genome Machine sequencer, assembled using Newbler and SPAdes software. The automatic genome annotation was done using the software RAST and in-house scripts for transference, followed by manual curation using Artemis software and BLAST against NCBI and UniProt databases. The six genomes are publicly available in NCBI database. The analysis of nucleotide sequence similarity and the generated phylogenetic tree led to the observation that the Mexican strains are more similar between strains from the same host, but the genetic structure is probably more influenced by transportation of animals between farms than host preference. Also, a putative drug target was predicted and in silico analysis of 46 strains showed two gene clusters capable of differentiating the biovars equi and ovis: Restriction Modification system and CRISPR-Cas cluster.

RevDate: 2018-10-19

Harrington LB, Burstein D, Chen JS, et al (2018)

Programmed DNA destruction by miniature CRISPR-Cas14 enzymes.

Science (New York, N.Y.) pii:science.aav4294 [Epub ahead of print].

CRISPR-Cas systems provide microbes with adaptive immunity to infectious nucleic acids and are widely employed as genome editing tools. These tools utilize RNA-guided Cas proteins whose large size (950-1400 amino acids) has been considered essential to their specific DNA- or RNA-targeting activities. Here we present a set of CRISPR-Cas systems from uncultivated archaea that contain Cas14, a family of exceptionally compact RNA-guided nucleases (400-700 amino acids). Despite their small size, Cas14 proteins are capable of targeted single-stranded DNA (ssDNA) cleavage without restrictive sequence requirements. Moreover, target recognition by Cas14 triggers non-specific cutting of ssDNA molecules, an activity that enables high-fidelity SNP genotyping (Cas14-DETECTR). Metagenomic data show that multiple CRISPR-Cas14 systems evolved independently and suggest a potential evolutionary origin of single-effector CRISPR-based adaptive immunity.

RevDate: 2018-10-18
CmpDate: 2018-10-18

Mattei TA (2018)

The CRISPR-Cas9 Genome Editing System: Not as Precise as Previously Believed.

World neurosurgery, 118:377-378.

RevDate: 2018-10-19
CmpDate: 2018-10-19

Mucha O, Podkalicka P, Czarnek M, et al (2018)

Pharmacological versus genetic inhibition of heme oxygenase-1 - the comparison of metalloporphyrins, shRNA and CRISPR/Cas9 system.

Acta biochimica Polonica, 65(2):277-286.

Inhibition of heme oxygenase-1 (HO-1, encoded by HMOX1), a cytoprotective, anti-apoptotic and anti-inflammatory enzyme, may serve as a valuable therapy in various pathophysiological processes, including tumorigenesis. We compared the effect of chemical inhibitors - metalloporphyrins, with genetic tools - shRNA and CRISPR/Cas9 systems, to knock-down (KD)/knock-out (KO) HO-1 expression/activity. 293T cells were incubated with metalloporphyrins, tin and zinc protoporphyrins (SnPPIX and ZnPPIX, respectively) or were either transduced with lentiviral vectors encoding different shRNA sequences against HO-1 or were modified by CRISPR/Cas9 system targeting HMOX1. Metalloporphyrins decreased HO activity but concomitantly strongly induced HO-1 mRNA and protein in 293T cells. On the other hand, only slight basal HO-1 inhibition in shRNA KD 293T cell lines was confirmed on mRNA and protein level with no significant effect on enzyme activity. Nevertheless, silencing effect was much stronger when CRISPR/Cas9-mediated knock-out was performed. Most of the clones harboring mutations within HMOX1 locus did not express HO-1 protein and failed to increase bilirubin concentration after hemin stimulation. Furthermore, CRISPR/Cas9-mediated HO-1 depletion decreased 293T viability, growth, clonogenic potential and increased sensitivity to H2O2 treatment. In summary, we have shown that not all technologies can be used for inhibition of HO activity in vitro with the same efficiency. In our hands, the most potent and comprehensible results can be obtained using genetic tools, especially CRISPR/Cas9 approach.

RevDate: 2018-10-17

Gong T, Tang B, Zhou X, et al (2018)

Genome editing in Streptococcus mutans through self-targeting CRISPR arrays.

Molecular oral microbiology [Epub ahead of print].

Streptococcus mutans is the primary aetiological agent of human dental caries. Its major virulence factors, glucosyltransferases (Gtfs), utilize sucrose to synthesize extracellular polysaccharides (EPS), leading to the formation of dental plaque biofilm. The current study was designed to develop a novel self-targeting gene editing technology that targeted gtfs to inhibit biofilms formation. The CRISPR-Cas system (i.e., clustered regularly interspaced short palindromic repeat, with CRISPR-associated proteins) provides sequence-specific protection against foreign genetic materials in archaea and bacteria,and has been widely developed for genomic engineering. The first aim of this study was to test whether components of the CRISPR-Cas9 system from S. mutans UA159 is necessary to defend against foreign DNA. The data showed that a suitable PAM site, tracrRNA, Cas9, and RNase III are indispensable elements to perform normal function of S. mutans CRISPR-Cas9 system. Based on these results, we designed self-targeting CRISPR arrays (containing spacer sequences identifying with gtfB) and cloned them onto plasmids. Afterwards, we transformed the plasmids and editing templates into UA159 (self-targeting) to acquire desired mutants. Our data showed that this technology performed well and was able to successfully edit gtfB or gtfBgtfC genes. This resulted in high reduction of EPS synthesis and was able to breakdown biofilm formation, which is also a promising tool for dental clinics in order to prevent the formation of S. mutans biofilms in the future. This article is protected by copyright. All rights reserved.

RevDate: 2018-10-16

Dong C, Fontana J, Patel A, et al (2018)

Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria.

Nature communications, 9(1):4318 pii:10.1038/s41467-018-06909-4.

In the original version of the Supplementary Information file associated with this Article, the sequence '1x MS2 scRNA.b2' was incorrectly given as 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT' and should have read 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACATGAGGATCACCCATGTGCTTTTTTT'. The error has now been fixed and the corrected version of the Supplementary Information PDF is available to download from the HTML version of the Article.

RevDate: 2018-10-17

Lone BA, Karna SKL, Ahmad F, et al (2018)

CRISPR/Cas9 System: A Bacterial Tailor for Genomic Engineering.

Genetics research international, 2018:3797214.

Microbes use diverse defence strategies that allow them to withstand exposure to a variety of genome invaders such as bacteriophages and plasmids. One such defence strategy is the use of RNA guided endonuclease called CRISPR-associated (Cas) 9 protein. The Cas9 protein, derived from type II CRISPR/Cas system, has been adapted as a versatile tool for genome targeting and engineering due to its simplicity and high efficiency over the earlier tools such as ZFNs and TALENs. With recent advancements, CRISPR/Cas9 technology has emerged as a revolutionary tool for modulating the genome in living cells and inspires innovative translational applications in different fields. In this paper we review the developments and its potential uses in the CRISPR/Cas9 technology as well as recent advancements in genome engineering using CRISPR/Cas9.

RevDate: 2018-10-16

Bron PA, Marcelli B, Mulder J, et al (2018)

Renaissance of traditional DNA transfer strategies for improvement of industrial lactic acid bacteria.

Current opinion in biotechnology, 56:61-68 pii:S0958-1669(18)30106-X [Epub ahead of print].

The ever-expanding genomic insight in natural diversity of lactic acid bacteria (LAB) has revived the industrial interest in traditional and natural genetic mobilization methodologies. Here, we review recent advances in horizontal gene transfer processes in LAB, including natural competence, conjugation, and phage transduction. In addition, we envision the possibilities for industrial strain improvement arising from the recent discoveries of molecular exchanges between bacteria through nanotubes and extracellular vesicles, as well as the constantly expanding genome editing possibilities using the CRISPR-Cas technology.

RevDate: 2018-10-09

Villiger L, Grisch-Chan HM, Lindsay H, et al (2018)

Treatment of a metabolic liver disease by in vivo genome base editing in adult mice.

Nature medicine, 24(10):1519-1525.

CRISPR-Cas-based genome editing holds great promise for targeting genetic disorders, including inborn errors of hepatocyte metabolism. Precise correction of disease-causing mutations in adult tissues in vivo, however, is challenging. It requires repair of Cas9-induced double-stranded DNA (dsDNA) breaks by homology-directed mechanisms, which are highly inefficient in nondividing cells. Here we corrected the disease phenotype of adult phenylalanine hydroxylase (Pah)enu2 mice, a model for the human autosomal recessive liver disease phenylketonuria (PKU)1, using recently developed CRISPR-Cas-associated base editors2-4. These systems enable conversion of C∙G to T∙A base pairs and vice versa, independent of dsDNA break formation and homology-directed repair (HDR). We engineered and validated an intein-split base editor, which allows splitting of the fusion protein into two parts, thereby circumventing the limited cargo capacity of adeno-associated virus (AAV) vectors. Intravenous injection of AAV-base editor systems resulted in Pahenu2 gene correction rates that restored physiological blood phenylalanine (L-Phe) levels below 120 µmol/l [5]. We observed mRNA correction rates up to 63%, restoration of phenylalanine hydroxylase (PAH) enzyme activity, and reversion of the light fur phenotype in Pahenu2 mice. Our findings suggest that targeting genetic diseases in vivo using AAV-mediated delivery of base-editing agents is feasible, demonstrating potential for therapeutic application.

RevDate: 2018-10-11

Du L, Zhou A, Sohr A, et al (2018)

An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing.

Journal of visualized experiments : JoVE.

Binary transcription systems are powerful genetic tools widely used for visualizing and manipulating cell fate and gene expression in specific groups of cells or tissues in model organisms. These systems contain two components as separate transgenic lines. A driver line expresses a transcriptional activator under the control of tissue-specific promoters/enhancers, and a reporter/effector line harbors a target gene placed downstream to the binding site of the transcription activator. Animals harboring both components induce tissue-specific transactivation of a target gene expression. Precise spatiotemporal expression of the gene in targeted tissues is critical for unbiased interpretation of cell/gene activity. Therefore, developing a method for generating exclusive cell/tissue-specific driver lines is essential. Here we present a method to generate highly tissue-specific targeted expression system by employing a "Clustered Regularly Interspaced Short Palindromic Repeat/CRISPR-associated" (CRISPR/Cas)-based genome editing technique. In this method, the endonuclease Cas9 is targeted by two chimeric guide RNAs (gRNA) to specific sites in the first coding exon of a gene in the Drosophila genome to create double-strand breaks (DSB). Subsequently, using an exogenous donor plasmid containing the transactivator sequence, the cell-autonomous repair machinery enables homology-directed repair (HDR) of the DSB, resulting in precise deletion and replacement of the exon with the transactivator sequence. The knocked-in transactivator is expressed exclusively in cells where the cis-regulatory elements of the replaced gene are functional. The detailed step-by-step protocol presented here for generating a binary transcriptional driver expressed in Drosophila fgf/branchless-producing epithelial/neuronal cells can be adopted for any gene- or tissue-specific expression.

RevDate: 2018-10-08

Ali Q (2018)

Non-conventional therapeutic technique to replace CRISPR bacteria from biofilm by inducible lysogen.

Journal of biological dynamics [Epub ahead of print].

Bacteriophage can be an effective means of regulating bacterial populations when conditions allow phage invasion of bacterial colonies. Phage can either infect and lyse a host cell, or insert their DNA into the host cell genome; the latter process is called lysogeny. The clustered regularly interspaced short palindromic repeat (CRISPR) system, linked with CRISPR-associated (Cas) genes, is a regulatory system present in a variety of bacteria which confers immunity against bacteriophage. Studies of the group behaviour of bacteria with CRISPR/Cas systems have provided evidence that CRISPR in lysogenized bacteria can cause an inability to form biofilm. This allows CRISPR-immune bacteria in biofilms to effectively resist phage therapy. Our recent work has described a potential therapeutic technique to eradicate CRISPR-immune bacteria from a biofilm by a continuous influx of lysogens carrying an identical phage sequence. However, this model predicted that the CRISPR-immune population could persist for long times before eradication. Our current focus is on the use of diverse lysogens against CRISPR-capable bacterial populations. The goal of this work is to find a suitable strategy which can eradicate bacteria with a CRISPR system through the influx of finite amounts of distinct lysogens over fixed intervals.

RevDate: 2018-10-05

Chen S, Liu H, Liang W, et al (2018)

Insert sequences of CRISPR/Cas system regulate horizontal antibiotic gene transfer in Shigella.

International journal of antimicrobial agents pii:S0924-8579(18)30279-6 [Epub ahead of print].

Multidrug resistances Shigella is an enormous threat of public health. The resistance genes always located in plasmids, phages and integrons, which get into bacteria cells by horizontal gene transfer (HGT). CRISPR-Cas systems are adaptive immune systems in bacteria that are beneficial to resist phage infection and other mobile genetic elements. But this can come at a cost of inhibiting the acquisition of other beneficial genes through HGT. Here, we investigate how Shigella regulate the activity of the CRISPR/Cas system spontaneously, when it wants acquire exogenous gene that is necessary for its survival. We found that IS elements were identified in cas genes, such as IS600 in cse2, ISSfl2 in cas6e, IS629 in cse1- cas3. The number of spacers in CRISPR/Cas which strain containing IS was fewer compare with none IS. Interestingly, fewer spacers were also found in multi-drug resistance Shigella strains. Furthermore, we have constructed the genetic transferred antibiotic resistant strain by resistance plasmid transfer, to detect the CRISPR/Cas system changes in this two group strains. We found that cse2 gene had a new IS elements (IS600) in the antibiotic-resistant strain. The bioinformatics analyses showed that the IS600 insert hotspots in the cse2 gene were the TGC-GGC gene motifs and the tertiary structure of the Cse2 protein was different with IS600 or not. IS600 could bring a 5-order of magnitude (105) decrease in the relative expression of cse2 gene. This study has significant implication for further revealing the mechanism underlying the CRISPR/Cas-mediated antibiotic resistance gene horizontal transfer in Shigella.

RevDate: 2018-10-05

Tashkandi M, Ali Z, Aljedaani F, et al (2018)

Engineering resistance against Tomato yellow leaf curl virus via the CRISPR/Cas9 system in tomato.

Plant signaling & behavior [Epub ahead of print].

CRISPR/Cas systems confer molecular immunity against phages and conjugative plasmids in prokaryotes. Recently, CRISPR/Cas9 systems have been used to confer interference against eukaryotic viruses. Here, we engineered Nicotiana benthamiana and tomato (Solanum lycopersicum) plants with the CRISPR/Cas9 system to confer immunity against the Tomato yellow leaf curl virus (TYLCV). Targeting the TYLCV genome with Cas9-single guide RNA at the sequences encoding the coat protein (CP) or replicase (Rep) resulted in efficient virus interference, as evidenced by low accumulation of the TYLCV DNA genome in the transgenic plants. The CRISPR/Cas9-based immunity remained active across multiple generations in the N. benthamiana and tomato plants. Together, our results confirmed the efficiency of the CRISPR/Cas9 system for stable engineering of TYLCV resistance in N. benthamiana and tomato, and opens the possibilities of engineering virus resistance against single and multiple infectious viruses in other crops.

RevDate: 2018-10-09

Smith CIE, R Zain (2018)

Therapeutic Oligonucleotides: State of the Art.

Annual review of pharmacology and toxicology [Epub ahead of print].

Oligonucleotides (ONs) can interfere with biomolecules representing the entire extended central dogma. Antisense gapmer, steric block, spliceswitching ONs, and short interfering RNA drugs have been successfully developed. Moreover, antagomirs (antimicroRNAs), microRNA mimics, aptamers, DNAdecoys, DNAzymes, synthetic guide strands for CRISPR/Cas, and innate immunity-stimulating ONs are all in clinical trials. DNAtargeting, triplex-forming ONs and strand-invading ONs have made their mark on drug development research, but not yet as medicines. Both design and synthetic nucleic acid chemistry are crucial for achieving biologically active ONs. The dominating modifications are phosphorothioate linkages, base methylation, and numerous 2'-substitutions in the furanose ring, such as 2'-fluoro, O-methyl, or methoxyethyl. Locked nucleic acid and constrained ethyl, a related variant, are bridged forms where the 2'-oxygen connects to the 4'-carbon in the sugar. Phosphorodiamidate morpholino oligomers, carrying a modified heterocyclic backbone ring, have also been commercialized. Delivery remains a major obstacle, but systemic administration and intrathecal infusion are used for treatment of the liver and brain, respectively. Expected final online publication date for the Annual Review of Pharmacology and Toxicology Volume 59 is January 6, 2019. Please see http://www.annualreviews.org/page/journal/pubdates for revised estimates.

RevDate: 2018-10-04

Majumdar S, MP Terns (2018)

CRISPR RNA-guided DNA cleavage by reconstituted Type I-A immune effector complexes.

Extremophiles : life under extreme conditions pii:10.1007/s00792-018-1057-0 [Epub ahead of print].

Diverse CRISPR-Cas immune systems protect archaea and bacteria from viruses and other mobile genetic elements. All CRISPR-Cas systems ultimately function by sequence-specific destruction of invading complementary nucleic acids. However, each CRISPR system uses compositionally distinct crRNP [CRISPR (cr) RNA/Cas protein] immune effector complexes to recognize and destroy invasive nucleic acids by unique molecular mechanisms. Previously, we found that Type I-A (Csa) effector crRNPs from Pyrococcus furiosus function in vivo to eliminate invader DNA. Here, we reconstituted functional Type I-A effector crRNPs in vitro with recombinant Csa proteins and synthetic crRNA and characterized properties of crRNP assembly, target DNA recognition and cleavage. Six proteins (Csa 4-1, Cas3″, Cas3', Cas5a, Csa2, Csa5) are essential for selective target DNA binding and cleavage. Native gel shift analysis and UV-induced RNA-protein crosslinking demonstrate that Cas5a and Csa2 directly interact with crRNA 5' tag and guide sequences, respectively. Mutational analysis revealed that Cas3″ is the effector nuclease of the complex. Together, our results indicate that DNA cleavage by Type I-A crRNPs requires crRNA-guided and protospacer adjacent motif-dependent target DNA binding to unwind double-stranded DNA and expose single strands for progressive ATP-dependent 3'-5' cleavage catalyzed by integral Cas3' helicase and Cas3″ nuclease crRNP components.

RevDate: 2018-10-07

Terceti MS, Vences A, Matanza XM, et al (2018)

Molecular Epidemiology of Photobacterium damselae subsp. damselae Outbreaks in Marine Rainbow Trout Farms Reveals Extensive Horizontal Gene Transfer and High Genetic Diversity.

Frontiers in microbiology, 9:2155.

The marine bacterium Photobacterium damselae subsp. damselae is a pathogen for a variety of marine animals, as well as for humans, and is nowadays considered an emerging pathogen for fish of importance in marine aquaculture. Recent studies have suggested that outbreaks in fish farms are caused by multiclonal populations of this subspecies that exist in the environment. Here, we report the study of a collection of 31 strains isolated during the course of disease outbreaks in marine rainbow trout farms in Denmark in 1994, 1995, and 2006, respectively. A phylogenetic analysis based on the toxR gene sequence, and the screening of virulence-related genes uncovered a high genetic heterogeneity, even among strains isolated from the same fish farm at the same time. Moreover, comparative analysis of the whole genome sequences of four selected strains revealed a large number of differentially occurring genes, which included virulence genes, pPHDD1 plasmid, polysaccharide synthesis gene clusters, CRISPR-Cas systems and putative new mobile genetic elements. This study provides sound evidence that P. damselae subsp. damselae outbreaks in Danish rainbow trout farms were caused by multiclonal populations and that horizontal gene transfer constitutes a strong driving force in the generation of intraspecific diversity in this pathogen.

RevDate: 2018-10-04

Hasan MH, Davis LE, Bollavarapu RK, et al (2018)

Dynamin is required for efficient cytomegalovirus maturation and envelopment.

Journal of virology pii:JVI.01418-18 [Epub ahead of print].

Cytomegalovirus secondary envelopment occurs in a virus-induced cytoplasmic assembly compartment (vAC) generated via a drastic reorganization of the membranes of the secretory and endocytic systems. Dynamin is a eukaryotic GTPase that is implicated in membrane remodeling and endocytic membrane fission events; however, the role of dynamin in cellular trafficking of viruses beyond virus entry is only partially understood. Mouse embryonic fibroblasts (MEF) engineered to excise all three isoforms of dynamin were infected with mouse cytomegalovirus (MCMV-K181). Immediate early (IE1; m123) viral protein was detected in these triple dynamin knockout (TKO) cells as well as in mock-induced parental MEF at early times post infection although levels were reduced in TKO cells, indicating that virus entry was affected but not eliminated. Levels of IE1 protein and another viral early protein (m04) were normalized by 48 hours post infection; however, late protein (m55; gB) expression was reduced in infected TKO cells compared to parental MEF. Ultrastructural analysis revealed intact stages of nuclear virus maturation in both cases with equivalent numbers of nucleocapsids containing packaged viral DNA (C-capsids) indicating successful viral DNA replication, capsid assembly and genome packaging. Most importantly, severe defects in virus envelopment were visualized in TKO cells but not in parental cells. Dynamin inhibitor (dynasore) treated MEF showed a phenotype similar to TKO cells upon MCMV infection confirming the role of dynamin in late maturation processes. In summary, dynamin-mediated endocytic pathways are critical for the completion of cytoplasmic stages of cytomegalovirus maturation.ImportanceViruses are known to exploit specific cellular functions at different stages of their life cycle in order to replicate, avoid immune recognition by the host and to establish a successful infection. Cytomegalovirus (CMV) infected cells are characterized by a prominent cytoplasmic inclusion (virus assembly compartment; vAC) that is the site of virus maturation and envelopment. While endocytic membranes are known to be the functional components of vAC, knowledge of specific endocytic pathways implicated in CMV maturation and envelopment is lacking. Here we show that dynamin, which is an integral part of host endocytic machinery, is largely dispensable for early stages of CMV infection but is required at a late stage of CMV maturation. Studies on dynamin function in CMV infection will help us understand the host-virus interaction pathways amenable to targeting by conventional small molecules as well as by newer generation nucleotide-based therapeutics (e.g. siRNA, CRISPR/CAS gRNA, etc.).

RevDate: 2018-10-03

Rui Y, Wilson DR, JJ Green (2018)

Non-Viral Delivery To Enable Genome Editing.

Trends in biotechnology pii:S0167-7799(18)30250-6 [Epub ahead of print].

Genome-editing technologies such as zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENS), and the clustered regularly interspaced short palindromic repeat (CRISPR)-associated protein system have revolutionized biological research. Each biotechnology consists of a DNA-binding protein that can be programmed to recognize and initiate double-strand breaks (DSBs) for site-specific gene modification. These technologies have the potential to be harnessed to cure diseases caused by aberrant gene expression. To be successful therapeutically, their functionality depends on their safe and efficient delivery into the cell nucleus. This review discusses the challenges in the delivery of genome-editing tools, and highlights recent innovations in non-viral delivery that have potential to overcome these limitations and advance the translation of genome editing towards patient care.

RevDate: 2018-10-02

Buerger P, Weynberg KD, Wood-Charlson EM, et al (2018)

Novel T4 bacteriophages associated with black band disease in corals.

Environmental microbiology [Epub ahead of print].

Research into causative agents underlying coral disease have focused primarily on bacteria, whereas potential roles of viruses have been largely unaddressed. Bacteriophages may contribute to diseases through the lysogenic introduction of virulence genes into bacteria, or prevent diseases through lysis of bacterial pathogens. To identify candidate phages that may influence the pathogenicity of black band disease (BBD), communities of bacteria (16S rRNA) and T4-bacteriophages (gp23) were simultaneously profiled with amplicon sequencing among BBD-lesions and healthy-coral-tissue of Montipora hispida, as well as seawater (study site: the central Great Barrier Reef). Bacterial community compositions were distinct among BBD-lesions, healthy-coral-tissue, and seawater samples, as observed in previous studies. Surprisingly, however, viral beta diversities based on both operational taxonomic unit (OTU)-compositions and overall viral community compositions did not differ statistically between the BBD-lesions and healthy-coral-tissue. Nonetheless, relative abundances of three bacteriophage OTUs, affiliated to Cyanophage PRSM6 and Prochlorococcus phages P-SSM2, were significantly higher in BBD-lesions than in healthy tissue. In addition, 32 gp23 OTUs showed nucleotide similarities to existing CRISPR-Cas spacers in BBD associated cyanobacterial genomes. These OTUs associated with our BBD samples suggest the presence of bacteriophages that infect members of the cyanobacteria-dominated BBD community, and thus have potential roles in BBD pathogenicity. This article is protected by copyright. All rights reserved.

RevDate: 2018-10-15
CmpDate: 2018-10-15

Hong KQ, Liu DY, Chen T, et al (2018)

Recent advances in CRISPR/Cas9 mediated genome editing in Bacillus subtilis.

World journal of microbiology & biotechnology, 34(10):153 pii:10.1007/s11274-018-2537-1.

Genome editing using engineered nucleases has rapidly transformed from a niche technology to a mainstream method used in various host cells. Its widespread adoption has been largely developed by the emergence of the clustered regularly interspaced short palindromic repeats (CRISPR) system, which uses an easily customizable specificity RNA-guided DNA endonuclease, such as Cas9. Recently, CRISPR/Cas9 mediated genome engineering has been widely applied to model organisms, including Bacillus subtilis, enabling facile, rapid high-fidelity modification of endogenous native genes. Here, we reviewed the recent progress in B. subtilis gene editing using CRISPR/Cas9 based tools, and highlighted state-of-the-art strategies for design of CRISPR/Cas9 system. Finally, future perspectives on the use of CRISPR/Cas9 genome engineering for sequence-specific genome editing in B. subtilis are provided.

RevDate: 2018-09-29

Morovic W, Roos P, Zabel B, et al (2018)

Transcriptional and functional analysis of Bifidobacterium animalis subsp. lactis exposure to tetracycline.

Applied and environmental microbiology pii:AEM.01999-18 [Epub ahead of print].

Commercial probiotic bacteria must be tested for acquired antibiotic resistance elements to avoid potential transfer to pathogens. The European Food Safety Authority recommends testing resistance using microdilution culture techniques previously used to establish inhibitory thresholds for the Bifidobacterium genus. Many Bifidobacterium animalis subsp. lactis strains exhibit increased resistance to tetracycline, historically attributed to the ribosomal protection gene tet(W). However, some strains that harbor genetically identical tet(W) genes show various inhibition levels suggesting that other genetic elements also contribute to observed differences. Here, we adapted several molecular assays to confirm the inhibition of B. animalis subsp. lactis strains Bl-04 and HN019, and employed RNA-seq to assess the transcriptional differences related to genomic polymorphisms. We detected specific stress responses to the antibiotic by correlating ATP concentration to viable genome copies from droplet digital PCR, and found that the bacteria were still metabolically active in high drug concentrations. Transcriptional analyses revealed that several polymorphic regions, particularly a novel multi-drug efflux transporter, were differentially expressed between the strains in each experimental condition, likely having phenotypic effects. We also found that the tet(W) gene was up-regulated only during sub-inhibitory tetracycline concentrations, while two novel tetracycline resistance genes were up-regulated at high concentrations. Furthermore, many genes involved in amino acid metabolism and transporter function were up-regulated while genes for complex carbohydrate utilization, protein metabolism, and CRISPR-Cas systems were down-regulated. These results provide high-throughput means for assessing antibiotic resistance and determine the genetic network that contributes to the global tetracycline response between two highly related probiotic strains.IMPORTANCEBifidobacterium animalis subsp. lactis is widely used in human food and dietary supplements. Although well documented to be safe, B. animalis subsp. lactis strains must not contain transferable antibiotic resistance elements. Many B. animalis subsp. lactis strains have different resistance measurements despite being genetically similar, and the reasons for this are not well understood. In the current study, we sought to examine how genomic differences between two closely related industrial B. animalis subsp. lactis strains contribute to different resistance levels. This will lead to a better understanding of resistance, identify future targets for analysis of transferability, and expand our understanding of tetracycline resistance in bacteria.

RevDate: 2018-10-02

Dank A, Smid EJ, RA Notebaart (2018)

CRISPR-Cas genome engineering of esterase activity in Saccharomyces cerevisiae steers aroma formation.

BMC research notes, 11(1):682 pii:10.1186/s13104-018-3788-5.

OBJECTIVE: Saccharomyces cerevisiae is used worldwide for the production of ale-type beers. This yeast is responsible for the production of the characteristic fruity aroma compounds. Esters constitute an important group of aroma active secondary metabolites produced by S. cerevisiae. Previous work suggests that esterase activity, which results in ester degradation, may be the key factor determining the abundance of fruity aroma compounds. Here, we test this hypothesis by deletion of two S. cerevisiae esterases, IAH1 and TIP1, using CRISPR-Cas9 genome editing and by studying the effect of these deletions on esterase activity and extracellular ester pools.

RESULTS: Saccharomyces cerevisiae mutants were constructed lacking esterase IAH1 and/or TIP1 using CRISPR-Cas9 genome editing. Esterase activity using 5-(6)-carboxyfluorescein diacetate (cFDA) as substrate was found to be significantly lower for ΔIAH1 and ΔIAH1ΔTIP1 mutants compared to wild type (WT) activity (P < 0.05 and P < 0.001, respectively). As expected, we observed an increase in relative abundance of acetate and ethyl esters and an increase in ethyl esters in ΔIAH1 and ΔTIP1, respectively. Interestingly, the double gene disruption mutant ΔIAH1ΔTIP1 showed an aroma profile comparable to WT levels, suggesting the existence and activation of a complex regulatory mechanism to compensate multiple genomic alterations in aroma metabolism.

RevDate: 2018-10-05

Hidalgo-Cantabrana C, Goh YJ, R Barrangou (2018)

Characterization and Repurposing of Type I and Type II CRISPR-Cas Systems in Bacteria.

Journal of molecular biology pii:S0022-2836(18)31107-0 [Epub ahead of print].

CRISPR-Cas systems constitute the adaptive immune system of bacteria and archaea, as a sequence-specific nucleic acid targeting defense mechanism. The sequence-specific recognition and cleavage of Cas effector complexes has been harnessed to developed CRISPR-based technologies and drive the genome editing revolution underway, due to their efficacy, efficiency, and ease of implementation in a broad range of organisms. CRISPR-based technologies offer a wide variety of opportunities in genome remodeling and transcriptional regulation, opening new avenues for therapeutic and biotechnological applications. To repurpose CRISPR-Cas systems for these applications, the various elements of the system need to be first identified and functionally characterized in their native host. Bioinformatic tools are first used to identify putative CRISPR arrays and their associated genes, followed by a comprehensive characterization of the CRISPR-Cas system, encompassing predictions for guide and target sequences. Subsequently, interference assays and transcriptomic analyses should be performed to probe the functionality of the CRISPR-Cas system. Once an endogenous CRISPR-Cas system is characterized as functional, they can be readily repurposed by delivering an engineered synthetic CRISPR array or a small RNA guide for targeted gene manipulation. Alternatively, developing a plasmid-based system for heterologous expression of the necessary CRISPR components can enable exploitation in other organisms. Altogether, there is a wide diversity of native CRISPR-Cas systems in many bacteria and most archaea that await functional characterization and repurposing for genome editing applications in prokaryotes.

RevDate: 2018-09-27

Ebrahimi S, Teimoori A, Khanbabaei H, et al (2018)

Harnessing CRISPR/Cas 9 System for manipulation of DNA virus genome.

Reviews in medical virology [Epub ahead of print].

The recent development of the Clustered Regularly Interspaced Palindromic Repeat (CRISPR)/CRISPR-associated protein 9 (Cas9) system, a genome editing system, has many potential applications in virology. The possibility of introducing site specific breaks has provided new possibilities to precisely manipulate viral genomics. Here, we provide diagrams to summarize the steps involved in the process. We also systematically review recent applications of the CRISPR/Cas9 system for manipulation of DNA virus genomics and discuss the therapeutic potential of the system to treat viral diseases.

RevDate: 2018-10-02

Karlapudi AP, T C V, Tammineedi J, et al (2018)

In silico sgRNA tool design for CRISPR control of quorum sensing in Acinetobacter species.

Genes & diseases, 5(2):123-129 pii:S2352-3042(18)30056-4.

CRISPR genome editing utilizes Cas9 nuclease and single guide RNA (sgRNA), which directs the nuclease to a specific site in the genome and makes a double-stranded break (DSB). Design of sgRNA for CRISPR-Cas targeting, and to promote CRISPR adaptation, uses a regulatory mechanism that ensures maximum CRISPR-Cas9 system functions when a bacterial population is at highest risk of phage infection. Acinetobacter baumannii is the most regularly identified gram-negative bacterium infecting patients. Recent reports have demonstrated that the extent of diseases caused by A. baumannii is expanding and, in a few cases, now surpasses the quantity of infections caused by P. aeruginosa. Most Acinetobacter strains possess biofilm-forming ability, which plays a major role in virulence and drug resistance. Biofilm bacteria use quorum sensing, a cell-to-cell communication process, to activate gene expression. Many genes are involved in biofilm formation and the mechanism to disrupt the biofilm network is still not clearly understood. In this study, we performed in silico gene editing to exploit the AbaI gene, responsible for biofilm formation. The study explored different tools available for genome editing to create gene knockouts, selecting the A. baumannii AbaI gene as a target.

RevDate: 2018-09-26

Adames NR, Gallegos JE, J Peccoud (2018)

Yeast genetic interaction screens in the age of CRISPR/Cas.

Current genetics pii:10.1007/s00294-018-0887-8 [Epub ahead of print].

The ease of performing both forward and reverse genetics in Saccharomyces cerevisiae, along with its stable haploid state and short generation times, has made this budding yeast the consummate model eukaryote for genetics. The major advantage of using budding yeast for reverse genetics is this organism's highly efficient homology-directed repair, allowing for precise genome editing simply by introducing DNA with homology to the chromosomal target. Although plasmid- and PCR-based genome editing tools are quite efficient, they depend on rare spontaneous DNA breaks near the target sequence. Consequently, they can generate only one genomic edit at a time, and the edit must be associated with a selectable marker. However, CRISPR/Cas technology is efficient enough to permit markerless and multiplexed edits in a single step. These features have made CRISPR/Cas popular for yeast strain engineering in synthetic biology and metabolic engineering applications, but it has not been widely employed for genetic screens. In this review, we critically examine different methods to generate multi-mutant strains in systematic genetic interaction screens and discuss the potential of CRISPR/Cas to supplement or improve on these methods.

RevDate: 2018-09-25

da Silva Xavier A, de Almeida JCF, de Melo AG, et al (2018)

Characterization of CRISPR-Cas systems in the Ralstonia solanacearum Species Complex.

Molecular plant pathology [Epub ahead of print].

Clustered regularly interspaced short palindromic repeats (CRISPRs) is an array of short DNA repeat sequences separated by unique spacer sequences that is flanked by associated (Cas) genes. CRISPR-Cas systems are found in the genome of several microbes and they can act as an adaptive immune mechanism against invading foreign nucleic acids such as phage genomes. Here, we studied the CRISPR-Cas systems in plant pathogenic bacteria of the Ralstonia solanacearum species complex (RSSC). A CRISPR-Cas system was found in 31% of RSSC genomes present in public databases. Specifically, CRISPR-Cas types I-E and II-C were found, with I-E being the most common. The presence of the same CRISPR-Cas types in distinct Ralstonia phylotypes and species suggests the acquisition of the system by a common ancestor before Ralstonia species segregation. Additionally, a Cas1 phylogeny (I-E type) showed a perfect geographical segregation of phylotypes, supporting an ancient acquisition. Ralstonia solanacearum strains CFBP2957 and K60T were challenged with a virulent phage, and the CRISPR arrays of bacteriophage-insensitive mutants (BIMs) were analyzed. No new spacer acquisition was detected in the analyzed BIMs. The functionality of the CRISPR-Cas interference step was also tested in R. solanacearum CFBP2957 using a spacer-PAM delivery system and no resistance was observed against phage phiAP1. Our results showed that the CRISPR-Cas system in R. solanacearum CFBP2957 is not its primary antiviral strategy. This article is protected by copyright. All rights reserved.

RevDate: 2018-09-25

Martin RM, Moniruzzaman M, Mucci NC, et al (2018)

Cylindrospermopsis raciborskii Virus and host: Genomic characterization and ecological relevance.

Environmental microbiology [Epub ahead of print].

Cylindrospermopsis (Raphidiopsis) raciborskii is an invasive, filamentous, nitrogen-fixing cyanobacterium that forms frequent blooms in freshwater habitats. While viruses play key roles in regulating the abundance, production, and diversity of their hosts in aquatic ecosystems, the role(s) of viruses in the ecology of C. raciborskii is almost unexplored. Progress in this field has been hindered by the absence of a characterized virus-host system in C. raciborskii. To bridge this gap, we sequenced the genome of CrV-01T, a previously isolated cyanosiphovirus, and its host C. raciborskii strain Cr2010. Analyses suggest that CrV-01T represents a distinct clade of siphoviruses infecting, and perhaps lysogenizing, filamentous cyanobacteria. Its genome contains unique features that include an intact CRISPR array and a 12-kb inverted duplication. Evidence suggests CrV-01T recently gained the ability to infect Cr2010 and recently lost the ability to form lysogens. The cyanobacterial host contains a CRISPR-Cas system with CRISPR spacers matching protospacers within the inverted duplication of the CrV-01T genome. Examination of metagenomes demonstrates that viruses with high genetic identity to CrV-01T, but lacking the inverted duplication, are present in C. raciborskii blooms in Australia. The unique genomic features of the CrV/Cr2010 system offers opportunities to investigate in more detail virus-host interactions in an ecologically important bloom-forming cyanobacterium. This article is protected by copyright. All rights reserved.

RevDate: 2018-10-04

Chabas H, Lion S, Nicot A, et al (2018)

Evolutionary emergence of infectious diseases in heterogeneous host populations.

PLoS biology, 16(9):e2006738 pii:pbio.2006738.

The emergence and re-emergence of pathogens remains a major public health concern. Unfortunately, when and where pathogens will (re-)emerge is notoriously difficult to predict, as the erratic nature of those events is reinforced by the stochastic nature of pathogen evolution during the early phase of an epidemic. For instance, mutations allowing pathogens to escape host resistance may boost pathogen spread and promote emergence. Yet, the ecological factors that govern such evolutionary emergence remain elusive because of the lack of ecological realism of current theoretical frameworks and the difficulty of experimentally testing their predictions. Here, we develop a theoretical model to explore the effects of the heterogeneity of the host population on the probability of pathogen emergence, with or without pathogen evolution. We show that evolutionary emergence and the spread of escape mutations in the pathogen population is more likely to occur when the host population contains an intermediate proportion of resistant hosts. We also show that the probability of pathogen emergence rapidly declines with the diversity of resistance in the host population. Experimental tests using lytic bacteriophages infecting their bacterial hosts containing Clustered Regularly Interspaced Short Palindromic Repeat and CRISPR-associated (CRISPR-Cas) immune defenses confirm these theoretical predictions. These results suggest effective strategies for cross-species spillover and for the management of emerging infectious diseases.

RevDate: 2018-09-28

Hsu DS, Kornepati AV, Glover W, et al (2018)

Targeting HPV16 DNA using CRISPR/Cas inhibits anal cancer growth in vivo.

Future virology, 13(7):475-482.

Aim: The goal of this study was to determine if a single AAV vector, encoding Cas9 and guide RNAs specific for the HPV16 E6 and E7 genes, could inhibit the growth of an HPV16-induced tumor in vivo.

Materials & methods: We grew HPV16+, patient-derived anal cancer explants in immunodeficient mice and then challenged these by injection of AAV-based vectors encoding Cas9 and control or HPV16-specific guide RNAs.

Results & conclusion: We observed a significant and selective reduction in tumor growth when the HPV16 E6 and E7 genes were targeted using Cas9. These studies provide proof of principle for the hypothesis that CRISPR/Cas has the potential to be used to selectively treat HPV-induced tumors in humans.

RevDate: 2018-09-28

Koonin EV (2018)

Open questions: CRISPR biology.

BMC biology, 16(1):95 pii:10.1186/s12915-018-0565-9.

CRISPR-Cas systems, the purveyors of adaptive immunity in archaea and bacteria and sources of the new generation of genome engineering tools, have been studied in exquisite molecular detail. However, when it comes to biological functions, ecology, and evolution of CRISPR-Cas, many more intriguing questions remain than there are answers.

RevDate: 2018-10-12

Zhang C, Konermann S, Brideau NJ, et al (2018)

Structural Basis for the RNA-Guided Ribonuclease Activity of CRISPR-Cas13d.

Cell, 175(1):212-223.e17.

CRISPR-Cas endonucleases directed against foreign nucleic acids mediate prokaryotic adaptive immunity and have been tailored for broad genetic engineering applications. Type VI-D CRISPR systems contain the smallest known family of single effector Cas enzymes, and their signature Cas13d ribonuclease employs guide RNAs to cleave matching target RNAs. To understand the molecular basis for Cas13d function and explain its compact molecular architecture, we resolved cryoelectron microscopy structures of Cas13d-guide RNA binary complex and Cas13d-guide-target RNA ternary complex to 3.4 and 3.3 Å resolution, respectively. Furthermore, a 6.5 Å reconstruction of apo Cas13d combined with hydrogen-deuterium exchange revealed conformational dynamics that have implications for RNA scanning. These structures, together with biochemical and cellular characterization, provide insights into its RNA-guided, RNA-targeting mechanism and delineate a blueprint for the rational design of improved transcriptome engineering technologies.

RevDate: 2018-09-21

Han W, Stella S, Zhang Y, et al (2018)

A Type III-B Cmr effector complex catalyzes the synthesis of cyclic oligoadenylate second messengers by cooperative substrate binding.

Nucleic acids research pii:5103948 [Epub ahead of print].

Recently, Type III-A CRISPR-Cas systems were found to catalyze the synthesis of cyclic oligoadenylates (cOAs), a second messenger that specifically activates Csm6, a Cas accessory RNase and confers antiviral defense in bacteria. To test if III-B CRISPR-Cas systems could mediate a similar CRISPR signaling pathway, the Sulfolobus islandicus Cmr-α ribonucleoprotein complex (Cmr-α-RNP) was purified from the native host and tested for cOA synthesis. We found that the system showed a robust production of cyclic tetra-adenylate (c-A4), and that c-A4 functions as a second messenger to activate the III-B-associated RNase Csx1 by binding to its CRISPR-associated Rossmann Fold domain. Investigation of the kinetics of cOA synthesis revealed that Cmr-α-RNP displayed positively cooperative binding to the adenosine triphosphate (ATP) substrate. Furthermore, mutagenesis of conserved domains in Cmr2α confirmed that, while Palm 2 hosts the active site of cOA synthesis, Palm 1 domain serves as the primary site in the enzyme-substrate interaction. Together, our data suggest that the two Palm domains cooperatively interact with ATP molecules to achieve a robust cOA synthesis by the III-B CRISPR-Cas system.

RevDate: 2018-09-21

Haverkamp THA, Geslin C, Lossouarn J, et al (2018)

Thermosipho spp. immune system differences affect variation in genome size and geographical distributions.

Genome biology and evolution pii:5098298 [Epub ahead of print].

Thermosipho species inhabit thermal environments such as marine hydrothermal vents, petroleum reservoirs and terrestrial hot springs. A 16S rRNA phylogeny of available Thermosipho spp. sequences suggested habitat specialists adapted to living in hydrothermal vents only, and habitat generalists inhabiting oil reservoirs, hydrothermal vents and hotsprings. Comparative genomics of 15 Thermosipho genomes separated them into three distinct species with different habitat distributions: the widely distributed T. africanus and the more specialized, T. melanesiensis and T. affectus. Moreover, the species can be differentiated on the basis of genome size, genome content and immune system composition. For instance, the T. africanus genomes are largest and contained the most carbohydrate metabolism genes, which could explain why these isolates were obtained from ecologically more divergent habitats. Nonetheless, all the Thermosipho genomes, like other Thermotogae genomes, show evidence of genome streamlining. Genome size differences between the species could further be correlated to differences in defense capacities against foreign DNA, which influence recombination via HGT. The smallest genomes are found in T. affectus that contain both CRISPR-cas Type I and III systems, but no RM system genes. We suggest that this has caused these genomes to be almost devoid of mobile elements, contrasting the two other species genomes that contain a higher abundance of mobile elements combined with different immune system configurations. Taken together, the comparative genomic analyses of Thermosipho spp. revealed genetic variation allowing habitat differentiation within the genus as well as differentiation with respect to invading mobile DNA.

RevDate: 2018-09-21

Shi TQ, Huang H, Kerkhoven EJ, et al (2018)

Advancing metabolic engineering of Yarrowia lipolytica using the CRISPR/Cas system.

Applied microbiology and biotechnology pii:10.1007/s00253-018-9366-x [Epub ahead of print].

The oleaginous yeast Yarrowia lipolytica is widely used for the production of both bulk and fine chemicals, including organic acids, fatty acid-derived biofuels and chemicals, polyunsaturated fatty acids, single-cell proteins, terpenoids, and other valuable products. Consequently, it is becoming increasingly popular for metabolic engineering applications. Multiple gene manipulation tools including URA blast, Cre/LoxP, and transcription activator-like effector nucleases (TALENs) have been developed for metabolic engineering in Y. lipolytica. However, the low efficiency and time-consuming procedures involved in these methods hamper further research. The emergence of the CRISPR/Cas system offers a potential solution for these problems due to its high efficiency, ease of operation, and time savings, which can significantly accelerate the genomic engineering of Y. lipolytica. In this review, we summarize the research progress on the development of CRISPR/Cas systems for Y. lipolytica, including Cas9 proteins and sgRNA expression strategies, as well as gene knock-out/knock-in and repression/activation applications. Finally, the most promising and tantalizing future prospects in this area are highlighted.

RevDate: 2018-09-20

Lander N, Chiurillo MA, Bertolini MS, et al (2018)

Calcium-sensitive pyruvate dehydrogenase phosphatase is required for energy metabolism, growth, differentiation, and infectivity of Trypanosoma cruzi.

The Journal of biological chemistry pii:RA118.004498 [Epub ahead of print].

In vertebrate cells, mitochondrial Ca2+ uptake by the mitochondrial calcium uniporter (MCU) leads to Ca2+-mediated stimulation of an intramitochondrial pyruvate dehydrogenase phosphatase (PDP). This enzyme dephosphorylates serine residues in the E1α subunit of pyruvate dehydrogenase (PDH), thereby activating PDH and resulting in increased ATP production. Although a phosphorylation-dephosphorylation cycle for the E1α subunit of PDH from non-vertebrate organisms has been described, the Ca2+-mediated PDP activation has not been studied. In this work we investigated the Ca2+ sensitivity of two recombinant PDPs from the protozoan human parasites Trypanosoma cruzi (TcPDP) and Trypanosoma brucei (TbPDP) and generated a TcPDP-KO cell line to establish TcPDP's role in cell bioenergetics and survival. Moreover, the mitochondrial localization of the TcPDP was studied by CRISPR/Cas9-mediated endogenous tagging. Our results indicate that TcPDP and TbPDP both are Ca2+-sensitive phosphatases. Of note, TcPDP-KO epimastigotes exhibited increased levels of phosphorylated TcPDH, slower growth and lower oxygen consumption rates than control cells, an increased AMP:ATP ratio and autophagy under starvation conditions, and reduced differentiation into infective metacyclic forms. Furthermore, TcPDP-KO trypomastigotes were impaired in infecting culture host cells. We conclude that TcPDP is a Ca2+-stimulated mitochondrial phosphatase that dephosphorylates TcPDH and is required for normal growth, differentiation, infectivity and energy metabolism in T. cruzi. Our results support the view that one of the main roles of the MCU is linked to the regulation of intramitochondrial dehydrogenases.

RevDate: 2018-09-21

Reimer KA, KM Neugebauer (2018)

Blood Relatives: Splicing Mechanisms underlying Erythropoiesis in Health and Disease.

F1000Research, 7:.

During erythropoiesis, hematopoietic stem and progenitor cells transition to erythroblasts en route to terminal differentiation into enucleated red blood cells. Transcriptome-wide changes underlie distinct morphological and functional characteristics at each cell division during this process. Many studies of gene expression have historically been carried out in erythroblasts, and the biogenesis of β-globin mRNA-the most highly expressed transcript in erythroblasts-was the focus of many seminal studies on the mechanisms of pre-mRNA splicing. We now understand that pre-mRNA splicing plays an important role in shaping the transcriptome of developing erythroblasts. Recent advances have provided insight into the role of alternative splicing and intron retention as important regulatory mechanisms of erythropoiesis. However, dysregulation of splicing during erythropoiesis is also a cause of several hematological diseases, including β-thalassemia and myelodysplastic syndromes. With a growing understanding of the role that splicing plays in these diseases, we are well poised to develop gene-editing treatments. In this review, we focus on changes in the developing erythroblast transcriptome caused by alternative splicing, the molecular basis of splicing-related blood diseases, and therapeutic advances in disease treatment using CRISPR/Cas9 gene editing.

RevDate: 2018-09-26

Liu Q, Fan D, Adah D, et al (2018)

CRISPR/Cas9‑mediated hypoxia inducible factor‑1α knockout enhances the antitumor effect of transarterial embolization in hepatocellular carcinoma.

Oncology reports, 40(5):2547-2557.

Transarterial embolization (TAE) is a palliative option commonly used for the treatment of advanced, unresectable hepatocellular carcinoma (HCC). However, patient prognosis in regards to overall survival has not improved with this method, mainly due to hypoxia‑inducible factor‑1α (HIF‑1α)‑induced angiogenesis and invasiveness. Thus, it is hypothesized that HIF‑1α may be an ideal knockout target for the treatment of HCC in combination with TAE. Thus, in the present study, HIF‑1α knockout was conducted in human liver cancer SMMC‑7721 cells and a xenograft HCC model was established using a lentivirus‑mediated CRISPR/Cas system (LV‑Cas) with small guide RNA‑721 (LV‑H721). Furthermore, hepatic artery ligation (HAL) was used to mimic human transarterial chemoembolization in mice. The results revealed that HIF‑1α was highly expressed in both HCC patient tissues and SMMC‑7721‑induced tumor tissues. The HIF‑1α knockout in SMMC‑7721 cells significantly suppressed cell invasiveness and migration, and induced cell apoptosis under CoCl2‑mimicking hypoxic conditions. Compared with the control groups, HAL + LV‑H721 inhibited SMMC‑7721 tumor growth in orthotopic HCC and markedly prolonged the survival of HCC‑bearing mice, which was accompanied by a lower CD31 expression (tumor angiogenesis) and increased apoptosis in the tumor cells. These findings demonstrated a valuable antitumor synergism in combining CRISPR/Cas9‑mediated HIF‑1α knockout with TAE in mice and highlighted the possibility that HIF‑1α may be an effective therapeutic knockout target in combination with TAE for HCC treatment.

RevDate: 2018-10-17
CmpDate: 2018-10-17

Oberhofer G, Ivy T, BA Hay (2018)

Behavior of homing endonuclease gene drives targeting genes required for viability or female fertility with multiplexed guide RNAs.

Proceedings of the National Academy of Sciences of the United States of America, 115(40):E9343-E9352.

A gene drive method of particular interest for population suppression utilizes homing endonuclease genes (HEGs), wherein a site-specific, nuclease-encoding cassette is copied, in the germline, into a target gene whose loss of function results in loss of viability or fertility in homozygous, but not heterozygous, progeny. Earlier work in Drosophila and mosquitoes utilized HEGs consisting of Cas9 and a single guide RNA (gRNA) that together target a specific gene for cleavage. Homing was observed, but resistant alleles immune to cleavage, while retaining wild-type gene function, were also created through nonhomologous end joining. Such alleles prevent drive and population suppression. Targeting a gene for cleavage at multiple positions has been suggested as a strategy to prevent the appearance of resistant alleles. To test this hypothesis, we generated two suppression HEGs in Drosophila melanogaster targeting genes required for embryonic viability or fertility, using a HEG consisting of CRISPR/Cas9 and gRNAs designed to cleave each gene at four positions. Rates of target locus cleavage were very high, and multiplexing of gRNAs prevented resistant allele formation. However, germline homing rates were modest, and the HEG cassette was unstable during homing events, resulting in frequent partial copying of HEGs that lacked gRNAs, a dominant marker gene, or Cas9. Finally, in drive experiments, the HEGs failed to spread due to the high fitness load induced in offspring as a result of maternal carryover of Cas9/gRNA complex activity. Alternative design principles are proposed that may mitigate these problems in future gene drive engineering.

RevDate: 2018-09-30

Marzec M, G Hensel (2018)

Targeted Base Editing Systems Are Available for Plants.

Trends in plant science pii:S1360-1385(18)30191-2 [Epub ahead of print].

Use of RNA-guided endonucleases for targeted genome editing is one of the most important breakthrough discoveries of the 21st century. Recent studies have described modifications of this precise base editing technique that open up a new dimension to plant genome editing.

RevDate: 2018-09-27

Dorn A, Röhrig S, Papp K, et al (2018)

The topoisomerase 3α zinc-finger domain T1 of Arabidopsis thaliana is required for targeting the enzyme activity to Holliday junction-like DNA repair intermediates.

PLoS genetics, 14(9):e1007674 pii:PGENETICS-D-18-01350.

Topoisomerase 3α, a class I topoisomerase, consists of a TOPRIM domain, an active centre and a variable number of zinc-finger domains (ZFDs) at the C-terminus, in multicellular organisms. Whereas the functions of the TOPRIM domain and the active centre are known, the specific role of the ZFDs is still obscure. In contrast to mammals where a knockout of TOP3α leads to lethality, we found that CRISPR/Cas induced mutants in Arabidopsis are viable but show growth retardation and meiotic defects, which can be reversed by the expression of the complete protein. However, complementation with AtTOP3α missing either the TOPRIM-domain or carrying a mutation of the catalytic tyrosine of the active centre leads to embryo lethality. Surprisingly, this phenotype can be overcome by the simultaneous removal of the ZFDs from the protein. In combination with a mutation of the nuclease AtMUS81, the TOP3α knockout proved to be also embryo lethal. Here, expression of TOP3α without ZFDs, and in particular without the conserved ZFD T1, leads to only a partly complementation in root growth-in contrast to the complete protein, that restores root length to mus81-1 mutant level. Expressing the E. coli resolvase RusA in this background, which is able to process Holliday junction (HJ)-like recombination intermediates, we could rescue this root growth defect. Considering all these results, we conclude that the ZFD T1 is specifically required for targeting the topoisomerase activity to HJ like recombination intermediates to enable their processing. In the case of an inactivated enzyme, this leads to cell death due to the masking of these intermediates, hindering their resolution by MUS81.

RevDate: 2018-10-02

Akcakaya P, Bobbin ML, Guo JA, et al (2018)

In vivo CRISPR editing with no detectable genome-wide off-target mutations.

Nature, 561(7723):416-419.

CRISPR-Cas genome-editing nucleases hold substantial promise for developing human therapeutic applications1-6 but identifying unwanted off-target mutations is important for clinical translation7. A well-validated method that can reliably identify off-targets in vivo has not been described to date, which means it is currently unclear whether and how frequently these mutations occur. Here we describe 'verification of in vivo off-targets' (VIVO), a highly sensitive strategy that can robustly identify the genome-wide off-target effects of CRISPR-Cas nucleases in vivo. We use VIVO and a guide RNA deliberately designed to be promiscuous to show that CRISPR-Cas nucleases can induce substantial off-target mutations in mouse livers in vivo. More importantly, we also use VIVO to show that appropriately designed guide RNAs can direct efficient in vivo editing in mouse livers with no detectable off-target mutations. VIVO provides a general strategy for defining and quantifying the off-target effects of gene-editing nucleases in whole organisms, thereby providing a blueprint to foster the development of therapeutic strategies that use in vivo gene editing.

RevDate: 2018-09-26

Cubbon A, Ivancic-Bace I, EL Bolt (2018)

CRISPR-Cas immunity, DNA repair and genome stability.

Bioscience reports, 38(5): pii:BSR20180457.

Co-opting of CRISPR-Cas 'Interference' reactions for editing the genomes of eukaryotic and prokaryotic cells has highlighted crucial support roles for DNA repair systems that strive to maintain genome stability. As front-runners in genome editing that targets DNA, the class 2 CRISPR-Cas enzymes Cas9 and Cas12a rely on repair of DNA double-strand breaks (DDSBs) by host DNA repair enzymes, using mechanisms that vary in how well they are understood. Data are emerging about the identities of DNA repair enzymes that support genome editing in human cells. At the same time, it is becoming apparent that CRISPR-Cas systems functioning in their native environment, bacteria or archaea, also need DNA repair enzymes. In this short review, we survey how DNA repair and CRISPR-Cas systems are intertwined. We consider how understanding DNA repair and CRISPR-Cas interference reactions in nature might help improve the efficacy of genome editing procedures that utilise homologous or analogous systems in human and other cells.

RevDate: 2018-09-12

Stanley SY, KL Maxwell (2018)

Phage-Encoded Anti-CRISPR Defenses.

Annual review of genetics [Epub ahead of print].

The battle for survival between bacteria and bacteriophages (phages) is an arms race where bacteria develop defenses to protect themselves from phages and phages evolve counterstrategies to bypass these defenses. CRISPR-Cas adaptive immune systems represent a widespread mechanism by which bacteria protect themselves from phage infection. In response to CRISPR-Cas, phages have evolved protein inhibitors known as anti-CRISPRs. Here, we describe the discovery and mechanisms of action of anti-CRISPR proteins. We discuss the potential impact of anti-CRISPRs on bacterial evolution, speculate on their evolutionary origins, and contemplate the possible next steps in the CRISPR-Cas evolutionary arms race. We also touch on the impact of anti-CRISPRs on the development of CRISPR-Cas-based biotechnological tools. Expected final online publication date for the Annual Review of Genetics Volume 52 is November 23, 2018. Please see http://www.annualreviews.org/page/journal/pubdates for revised estimates.

RevDate: 2018-10-12

Hidalgo-Cantabrana C, Sanozky-Dawes R, R Barrangou (2018)

Insights into the Human Virome Using CRISPR Spacers from Microbiomes.

Viruses, 10(9): pii:v10090479.

Due to recent advances in next-generation sequencing over the past decade, our understanding of the human microbiome and its relationship to health and disease has increased dramatically. Yet, our insights into the human virome, and its interplay with important microbes that impact human health, is relatively limited. Prokaryotic and eukaryotic viruses are present throughout the human body, comprising a large and diverse population which influences several niches and impacts our health at various body sites. The presence of prokaryotic viruses like phages, has been documented at many different body sites, with the human gut being the richest ecological niche. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and associated proteins constitute the adaptive immune system of bacteria, which prevents attack by invasive nucleic acid. CRISPR-Cas systems function by uptake and integration of foreign genetic element sequences into the CRISPR array, which constitutes a genomic archive of iterative vaccination events. Consequently, CRISPR spacers can be investigated to reconstruct interplay between viruses and bacteria, and metagenomic sequencing data can be exploited to provide insights into host-phage interactions within a niche. Here, we show how the CRISPR spacer content of commensal and pathogenic bacteria can be used to determine the evidence of their phage exposure. This framework opens new opportunities for investigating host-virus dynamics in metagenomic data, and highlights the need to dedicate more efforts for virome sampling and sequencing.

RevDate: 2018-09-24
CmpDate: 2018-09-24

Cai B, Sun S, Li Z, et al (2018)

Application of CRISPR/Cas9 technologies combined with iPSCs in the study and treatment of retinal degenerative diseases.

Human genetics, 137(9):679-688.

Retinal degeneration diseases, such as age-related macular degeneration and retinitis pigmentosa, affect millions of people worldwide and are major causes of irreversible blindness. Effective treatments for retinal degeneration, including drug therapy, gene augmentation or transplantation approaches, have been widely investigated. Nevertheless, more research should be dedicated to therapeutic methods to improve future clinical treatments. Recently, with the rapid development of genome-editing technology, gene therapy has become a potentially effective treatment for retinal degeneration diseases. A clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) system has been developed as a powerful genome-editing tool in ophthalmic studies. The CRISPR/Cas9 system has been widely applied in basic research to develop animal models and gene therapies in vivo. With the ability to self-renew and the potential to differentiate into different types of cells, induced pluripotent stem cells (iPSCs) have already been used as a promising tool for understanding disease pathophysiology and evaluating the effect of drug and gene therapeutics. iPSCs are also a cell source for autologous transplantation. In this review, we compared genome-editing strategies and highlighted the advantages and concerns of the CRISPR/Cas9 system. Moreover, the latest progress and applications of the CRISPR/Cas9 system and its combination with iPSCs for the treatment of retinal degenerative diseases are summarized.

RevDate: 2018-10-11
CmpDate: 2018-10-11

Viegas J (2018)

Profile of Dana Carroll.

Proceedings of the National Academy of Sciences of the United States of America, 115(38):9331-9333.

RevDate: 2018-10-11
CmpDate: 2018-10-11

Yarrington RM, Verma S, Schwartz S, et al (2018)

Nucleosomes inhibit target cleavage by CRISPR-Cas9 in vivo.

Proceedings of the National Academy of Sciences of the United States of America, 115(38):9351-9358.

Genome editing with CRISPR-Cas nucleases has been applied successfully to a wide range of cells and organisms. There is, however, considerable variation in the efficiency of cleavage and outcomes at different genomic targets, even within the same cell type. Some of this variability is likely due to the inherent quality of the interaction between the guide RNA and the target sequence, but some may also reflect the relative accessibility of the target. We investigated the influence of chromatin structure, particularly the presence or absence of nucleosomes, on cleavage by the Streptococcus pyogenes Cas9 protein. At multiple target sequences in two promoters in the yeast genome, we find that Cas9 cleavage is strongly inhibited when the DNA target is within a nucleosome. This inhibition is relieved when nucleosomes are depleted. Remarkably, the same is not true of zinc-finger nucleases (ZFNs), which cleave equally well at nucleosome-occupied and nucleosome-depleted sites. These results have implications for the choice of specific targets for genome editing, both in research and in clinical and other practical applications.

RevDate: 2018-09-10

Dangi AK, Sharma B, Hill RT, et al (2018)

Bioremediation through microbes: systems biology and metabolic engineering approach.

Critical reviews in biotechnology [Epub ahead of print].

Today, environmental pollution is a serious problem, and bioremediation can play an important role in cleaning contaminated sites. Remediation strategies, such as chemical and physical approaches, are not enough to mitigate pollution problems because of the continuous generation of novel recalcitrant pollutants due to anthropogenic activities. Bioremediation using microbes is an eco-friendly and socially acceptable alternative to conventional remediation approaches. Many microbes with a bioremediation potential have been isolated and characterized but, in many cases, cannot completely degrade the targeted pollutant or are ineffective in situations with mixed wastes. This review envisages advances in systems biology (SB), which enables the analysis of microbial behavior at a community level under different environmental stresses. By applying a SB approach, crucial preliminary information can be obtained for metabolic engineering (ME) of microbes for their enhanced bioremediation capabilities. This review also highlights the integrated SB and ME tools and techniques for bioremediation purposes.

RevDate: 2018-09-09

St John E, Liu Y, Podar M, et al (2018)

A new symbiotic nanoarchaeote (Candidatus Nanoclepta minutus) and its host (Zestosphaera tikiterensis gen. nov., sp. nov.) from a New Zealand hot spring.

Systematic and applied microbiology pii:S0723-2020(18)30226-1 [Epub ahead of print].

Three thermophilic Nanoarchaeota-Crenarchaeota symbiotic systems have been described. We obtained another stable anaerobic enrichment culture at 80°C, pH 6.0 from a New Zealand hot spring. The nanoarchaeote (Ncl-1) and its host (NZ3T) were isolated in co-culture and their genomes assembled. The small (∼200nm) flagellated cocci were often attached to larger cocci. Based on 16S rRNA gene similarity (88.4%) and average amino acid identity (52%), Ncl-1 is closely related to Candidatus Nanopusillus acidilobi. Their genomes both encode for archaeal flagella and partial glycolysis and gluconeogenesis pathways, but lack ATP synthase genes. Like Nanoarchaeum equitans, Ncl-1 has a CRISPR-Cas system. Ncl-1 also relies on its crenarchaeotal host for most of its biosynthetic needs. The host NZ3T was isolated and grows on proteinaceous substrates but not on sugars, alcohols, or fatty acids. NZ3T requires thiosulfate and grows best at 82°C, pH 6.0. NZ3T is most closely related to the Desulfurococcaceae, Ignisphaera aggregans (∼92% 16S rRNA gene sequence similarity, 45% AAI). Based on phylogenetic, physiological and genomic data, Ncl-1 and NZ3T represent novel genera in the Nanoarchaeota and the Desulfurococcaceae, respectively, with the proposed names Candidatus Nanoclepta minutus and Zestosphaera tikiterensis gen. nov., sp. nov., type strain NZ3T (=DSMZ 107634T=OCM 1213T).

RevDate: 2018-09-11

Gao Z, Herrera-Carrillo E, B Berkhout (2018)

RNA Polymerase II Activity of Type 3 Pol III Promoters.

Molecular therapy. Nucleic acids, 12:135-145.

In eukaryotes, three RNA polymerases (Pol I, II, and III) are responsible for the transcription of distinct subsets of genes. Gene-external type 3 Pol III promoters use defined transcription start and termination sites, and they are, therefore, widely used for small RNA expression, including short hairpin RNAs in RNAi applications and guide RNAs in CRISPR-Cas systems. We report that all three commonly used human Pol III promoters (7SK, U6, and H1) mediate luciferase reporter gene expression, which indicates Pol II activity, but to a different extent (H1 ≫ U6 > 7SK). We demonstrate that these promoters can recruit Pol II for transcribing extended messenger transcripts. Intriguingly, selective inhibition of Pol II stimulates the Pol III activity and vice versa, suggesting that two polymerase complexes compete for promoter usage. Pol II initiates transcription at the regular Pol III start site on the 7SK and U6 promoters, but Pol II transcription on the most active H1 promoter starts 8 nt upstream of the Pol III start site. This study provides functional evidence for the close relationship of Pol II and Pol III transcription. These mechanistic insights are important for optimal use of Pol III promoters, and they offer additional flexibility for biotechnology applications of these genetic elements.

RevDate: 2018-09-14
CmpDate: 2018-09-14

Karagyaur MN, Rubtsov YP, Vasiliev PA, et al (2018)

Practical Recommendations for Improving Efficiency and Accuracy of the CRISPR/Cas9 Genome Editing System.

Biochemistry. Biokhimiia, 83(6):629-642.

CRISPR/Cas9 genome-editing system is a powerful, fairly accurate, and efficient tool for modifying genomic DNA. Despite obvious advantages, it is not devoid of certain drawbacks, such as propensity for introduction of additional nonspecific DNA breaks, insufficient activity against aneuploid genomes, and relative difficulty in delivering its components to cells. In this review, we focus on the difficulties that can limit the use of CRISPR/Cas9 and suggest a number of practical recommendations and information sources that will make it easier for the beginners to work with this outstanding technological achievement of the XXI century.

RevDate: 2018-09-15

Faure G, Makarova KS, EV Koonin (2018)

CRISPR-Cas: Complex Functional Networks and Multiple Roles beyond Adaptive Immunity.

Journal of molecular biology pii:S0022-2836(18)31013-1 [Epub ahead of print].

CRISPR-Cas is a prokaryotic adaptive immune system that functions by incorporating fragments of foreign DNA into CRISPR arrays. The arrays containing spacers derived from foreign DNA are transcribed, and the transcripts are processed to generate spacer-containing mature CRISPR-RNAs that are employed as guides to specifically recognize and cleave the DNA or RNA of the cognate parasitic genetic elements. The CRISPR-Cas systems show remarkable complexity and diversity of molecular organization and appear to be involved in various cellular functions that are distinct from, even if connected to, adaptive immunity. In this review, we discuss some of such functional links of CRISPR-Cas systems including their effect on horizontal gene transfer that can be either inhibitory or stimulatory, connections between CRISPR-Cas and DNA repair systems as well as programmed cell death and signal transduction mechanisms, and potential role of CRISPR-Cas in transposon integration and plasmid maintenance. The interplay between the primary function of CRISPR-Cas as an adaptive immunity mechanism and these other roles defines the richness of the biological effects of these systems and affects their spread among bacteria and archaea.

RevDate: 2018-10-17

Vogel P, T Stafforst (2018)

Critical review on engineering deaminases for site-directed RNA editing.

Current opinion in biotechnology, 55:74-80 pii:S0958-1669(18)30067-3 [Epub ahead of print].

The game-changing role of CRISPR/Cas for genome editing draw interest to programmable RNA-guided tools in general. Currently, we see a wave of papers pioneering the CRISPR/Cas system for RNA targeting, and applying them for site-directed RNA editing. Here, we exemplarily compare three recent RNA editing strategies that rely on three distinct RNA targeting mechanisms. We conclude that the CRISPR/Cas system seems not generally superior to other RNA targeting strategies in solving the most pressing problem in the RNA editing field, which is to obtain high efficiency in combination with high specificity. However, once achieved, RNA editing promises to complement or even outcompete DNA editing approaches in therapy, and also in some fields of basic research.

RevDate: 2018-09-07

Shen Y, Cohen JL, Nicoloro SM, et al (2018)

CRISPR delivery particles targeting nuclear receptor-interacting protein 1 (Nrip1) in adipose cells to enhance energy expenditure.

The Journal of biological chemistry pii:RA118.004554 [Epub ahead of print].

RNA-guided, engineered nucleases derived from the prokaryotic adaptive immune system CRISPR-Cas represent a powerful platform for gene deletion and editing. When used as a therapeutic approach, direct delivery of Cas9 protein and single-guide (sg)RNA could circumvent the safety issues associated with plasmid delivery and therefore represents an attractive tool for precision genome engineering. Gene deletion or editing in adipose tissue to enhance its energy expenditure, fatty acid oxidation, and secretion of bioactive factors through a "browning" process presents a potential therapeutic strategy to alleviate metabolic disease. Here, we developed "CRISPR-delivery particles," denoted CriPs, composed of nano-size complexes of Cas9 protein and sgRNA that are coated with an amphipathic peptide called Endo-Porter that mediates entry into cells. Efficient CRISPR-Cas9-mediated gene deletion of ectopically expressed GFP by CriPs was achieved in multiple cell types, including a macrophage cell line, primary macrophages, and primary preadipocytes. Significant GFP loss was also observed in peritoneal exudate cells with minimum systemic toxicity in GFP-expressing mice following intraperitoneal injection of CriPs containing Gfp-targeting sgRNA. Furthermore, disruption of a nuclear co-repressor of catabolism, the Nrip1 gene, in white adipocytes by CriPs enhanced adipocyte "browning" with a marked increase of uncoupling protein 1 (UCP1) expression. Of note, the CriP-mediated Nrip1 deletion did not produce detectable off-target effects. We conclude that CriPs offer an effective Cas9 and sgRNA delivery system for ablating targeted gene products in cultured cells and in vivo, providing a potential therapeutic strategy for metabolic disease.

RevDate: 2018-10-15

Marino ND, Zhang JY, Borges AL, et al (2018)

Discovery of widespread type I and type V CRISPR-Cas inhibitors.

Science (New York, N.Y.), 362(6411):240-242.

Bacterial CRISPR-Cas systems protect their host from bacteriophages and other mobile genetic elements. Mobile elements, in turn, encode various anti-CRISPR (Acr) proteins to inhibit the immune function of CRISPR-Cas. To date, Acr proteins have been discovered for type I (subtypes I-D, I-E, and I-F) and type II (II-A and II-C) but not other CRISPR systems. Here, we report the discovery of 12 acr genes, including inhibitors of type V-A and I-C CRISPR systems. AcrVA1 inhibits a broad spectrum of Cas12a (Cpf1) orthologs-including MbCas12a, Mb3Cas12a, AsCas12a, and LbCas12a-when assayed in human cells. The acr genes reported here provide useful biotechnological tools and mark the discovery of acr loci in many bacteria and phages.

RevDate: 2018-10-17

Verkuijl SA, MG Rots (2018)

The influence of eukaryotic chromatin state on CRISPR-Cas9 editing efficiencies.

Current opinion in biotechnology, 55:68-73 pii:S0958-1669(18)30051-X [Epub ahead of print].

CRISPR/Cas technologies have rapidly become in routine use for site-directed genetic or transcriptional manipulation. Despite this, the efficiency of CRISPR/Cas9 functioning cannot entirely be predicted, and it is not fully understood which factors contribute to this variability. Recent studies indicate that heterochromatin can negatively affect Cas9 binding and functioning. Investigating chromatin factors indicates that DNA cytosine-5 methylation does not directly block Cas9 binding. Nucleosomes, however, can completely block Cas9 access to DNA in cell-free assays and present a substantial hurdle in vivo. In addition to being associated with an open chromatin state, active transcription can directly stimulate DNA cleavage by influencing Cas9 release rates in a strand-specific manner. With these insights and a better understanding of genome-wide chromatin and transcription states, CRISPR/Cas9 effectiveness and reliability can be improved.

RevDate: 2018-09-06

Radovcic M, Killelea T, Savitskaya E, et al (2018)

CRISPR-Cas adaptation in Escherichia coli requires RecBCD helicase but not nuclease activity, is independent of homologous recombination, and is antagonized by 5' ssDNA exonucleases.

Nucleic acids research pii:5090770 [Epub ahead of print].

Prokaryotic adaptive immunity is established against mobile genetic elements (MGEs) by 'naïve adaptation' when DNA fragments from a newly encountered MGE are integrated into CRISPR-Cas systems. In Escherichia coli, DNA integration catalyzed by Cas1-Cas2 integrase is well understood in mechanistic and structural detail but much less is known about events prior to integration that generate DNA for capture by Cas1-Cas2. Naïve adaptation in E. coli is thought to depend on the DNA helicase-nuclease RecBCD for generating DNA fragments for capture by Cas1-Cas2. The genetics presented here show that naïve adaptation does not require RecBCD nuclease activity but that helicase activity may be important. RecA loading by RecBCD inhibits adaptation explaining previously observed adaptation phenotypes that implicated RecBCD nuclease activity. Genetic analysis of other E. coli nucleases and naïve adaptation revealed that 5' ssDNA tailed DNA molecules promote new spacer acquisition. We show that purified E. coli Cas1-Cas2 complex binds to and nicks 5' ssDNA tailed duplexes and propose that E. coli Cas1-Cas2 nuclease activity on such DNA structures supports naïve adaptation.

RevDate: 2018-10-10
CmpDate: 2018-10-10

Wall RJ, Rico E, Lukac I, et al (2018)

Clinical and veterinary trypanocidal benzoxaboroles target CPSF3.

Proceedings of the National Academy of Sciences of the United States of America, 115(38):9616-9621.

African trypanosomes cause lethal and neglected tropical diseases, known as sleeping sickness in humans and nagana in animals. Current therapies are limited, but fortunately, promising therapies are in advanced clinical and veterinary development, including acoziborole (AN5568 or SCYX-7158) and AN11736, respectively. These benzoxaboroles will likely be key to the World Health Organization's target of disease control by 2030. Their mode of action was previously unknown. We have developed a high-coverage overexpression library and use it here to explore drug mode of action in Trypanosoma brucei Initially, an inhibitor with a known target was used to select for drug resistance and to test massive parallel library screening and genome-wide mapping; this effectively identified the known target and validated the approach. Subsequently, the overexpression screening approach was used to identify the target of the benzoxaboroles, Cleavage and Polyadenylation Specificity Factor 3 (CPSF3, Tb927.4.1340). We validated the CPSF3 endonuclease as the target, using independent overexpression strains. Knockdown provided genetic validation of CPSF3 as essential, and GFP tagging confirmed the expected nuclear localization. Molecular docking and CRISPR-Cas9-based editing demonstrated how acoziborole can specifically block the active site and mRNA processing by parasite, but not host CPSF3. Thus, our findings provide both genetic and chemical validation for CPSF3 as an important drug target in trypanosomes and reveal inhibition of mRNA maturation as the mode of action of the trypanocidal benzoxaboroles. Understanding the mechanism of action of benzoxaborole-based therapies can assist development of improved therapies, as well as the prediction and monitoring of resistance, if or when it arises.

RevDate: 2018-10-06

Ortigosa A, Gimenez-Ibanez S, Leonhardt N, et al (2018)

Design of a bacterial speck resistant tomato by CRISPR/Cas9-mediated editing of SlJAZ2.

Plant biotechnology journal [Epub ahead of print].

Due to their different lifestyles, effective defence against biotrophic pathogens normally leads to increased susceptibility to necrotrophs, and vice versa. Solving this trade-off is a major challenge for obtaining broad-spectrum resistance in crops and requires uncoupling the antagonism between the jasmonate (JA) and salicylate (SA) defence pathways. Pseudomonas syringae pv. tomato (Pto) DC3000, the causal agent of tomato bacterial speck disease, produces coronatine (COR) that stimulates stomata opening and facilitates bacterial leaf colonization. In Arabidopsis, stomata response to COR requires the COR co-receptor AtJAZ2, and dominant AtJAZ2Δjas repressors resistant to proteasomal degradation prevent stomatal opening by COR. Here, we report the generation of a tomato variety resistant to the bacterial speck disease caused by PtoDC3000 without compromising resistance to necrotrophs. We identified the functional ortholog of AtJAZ2 in tomato, found that preferentially accumulates in stomata and proved that SlJAZ2 is a major co-receptor of COR in stomatal guard cells. SlJAZ2 was edited using CRISPR/Cas9 to generate dominant JAZ2 repressors lacking the C-terminal Jas domain (SlJAZ2Δjas). SlJAZ2Δjas prevented stomatal reopening by COR and provided resistance to PtoDC3000. Water transpiration rate and resistance to the necrotrophic fungal pathogen Botrytis cinerea, causal agent of the tomato gray mold, remained unaltered in Sljaz2Δjas plants. Our results solve the defence trade-off in a crop, by spatially uncoupling the SA-JA hormonal antagonism at the stomata, entry gates of specific microbes such as PtoDC3000. Moreover, our results also constitute a novel CRISPR/Cas-based strategy for crop protection that could be readily implemented in the field.

RevDate: 2018-10-15
CmpDate: 2018-10-15

Tian H, Luo J, Zhang Z, et al (2018)

CRISPR/Cas9-mediated Stearoyl-CoA Desaturase 1 (SCD1) Deficiency Affects Fatty Acid Metabolism in Goat Mammary Epithelial Cells.

Journal of agricultural and food chemistry, 66(38):10041-10052.

Stearoyl-CoA desaturase 1 (SCD1) is a fatty acid desaturase catalyzing cis-double-bond formation in the Δ9 position to produce monounsaturated fatty acids essential for the synthesis of milk fat. Previous studies using RNAi methods have provided support for a role of SCD1 in goat mammary epithelial cells (GMEC); however, RNAi presents several limitations that might preclude a truthful understanding of the biological function of SCD1. To explore the function of SCD1 on fatty acid metabolism in GMEC, we used CRISPR-Cas9-mediated SCD1 knockout through non-homologous end-joining (NHEJ) and homology-directed repair (HDR) pathways in GMEC. We successfully introduced nucleotide deletions and mutations in the SCD1 gene locus through the NHEJ pathway and disrupted its second exon via insertion of an EGFP-PuroR segment using the HDR pathway. In clones derived from the latter, gene- and protein-expression data indicated that we obtained a monoallelic SCD1 knockout. A T7EN1-mediated assay revealed no off-targets in the surveyed sites. The contents of triacylglycerol and cholesterol and the desaturase index were significantly decreased as a consequence of SCD1 knockout. The deletion of SCD1 decreased the expression of other genes involved in de novo fatty acid synthesis, including SREBF1 and FASN, as well the fatty acid transporters FABP3 and FABP4. The downregulation of these genes partly explains the decrease of intracellular triacylglycerols. Our results indicate a successful SCD1 knockout in goat mammary cells using CRISPR-Cas9. The demonstration of the successful use of CRISPR-Cas9 in GMEC is an important step to producing transgenic goats to study mammary biology in vivo.

RevDate: 2018-09-05

Tagini F, Pillonel T, Croxatto A, et al (2018)

Distinct Genomic Features Characterize Two Clades of Corynebacterium diphtheriae: Proposal of Corynebacterium diphtheriae Subsp. diphtheriae Subsp. nov. and Corynebacterium diphtheriae Subsp. lausannense Subsp. nov.

Frontiers in microbiology, 9:1743.

Corynebacterium diphtheriae is the etiological agent of diphtheria, a disease caused by the presence of the diphtheria toxin. However, an increasing number of records report non-toxigenic C. diphtheriae infections. Here, a C. diphtheriae strain was recovered from a patient with a past history of bronchiectasis who developed a severe tracheo-bronchitis with multiple whitish lesions of the distal trachea and the mainstem bronchi. Whole-genome sequencing (WGS), performed in parallel with PCR targeting the toxin gene and the Elek test, provided clinically relevant results in a short turnaround time, showing that the isolate was non-toxigenic. A comparative genomic analysis of the new strain (CHUV2995) with 56 other publicly available genomes of C. diphtheriae revealed that the strains CHUV2995, CCUG 5865 and CMCNS703 share a lower average nucleotide identity (ANI) (95.24 to 95.39%) with the C. diphtheriae NCTC 11397T reference genome than all other C. diphtheriae genomes (>98.15%). Core genome phylogeny confirmed the presence of two monophyletic clades. Based on these findings, we propose here two new C. diphtheriae subspecies to replace the lineage denomination used in previous multilocus sequence typing studies: C. diphtheriae subsp. lausannense subsp. nov. (instead of lineage-2), regrouping strains CHUV2995, CCUG 5865, and CMCNS703, and C. diphtheriae subsp. diphtheriae subsp. nov, regrouping all other C. diphtheriae in the dataset (instead of lineage-1). Interestingly, members of subspecies lausannense displayed a larger genome size than subspecies diphtheriae and were enriched in COG categories related to transport and metabolism of lipids (I) and inorganic ion (P). Conversely, they lacked all genes involved in the synthesis of pili (SpaA-type, SpaD-type and SpaH-type), molybdenum cofactor and of the nitrate reductase. Finally, the CHUV2995 genome is particularly enriched in mobility genes and harbors several prophages. The genome encodes a type II-C CRISPR-Cas locus with 2 spacers that lacks csn2 or cas4, which could hamper the acquisition of new spacers and render strain CHUV2995 more susceptible to bacteriophage infections and gene acquisition through various mechanisms of horizontal gene transfer.

RevDate: 2018-09-03

Liu Q, Yu T, Campbell K, et al (2018)

Modular Pathway Rewiring of Yeast for Amino Acid Production.

Methods in enzymology, 608:417-439.

Amino acids find various applications in biotechnology in view of their importance in the food, feed, pharmaceutical, and personal care industries as nutrients, additives, and drugs, respectively. For the large-scale production of amino acids, microbial cell factories are widely used and the development of amino acid-producing strains has mainly focused on prokaryotes Corynebacterium glutamicum and Escherichia coli. However, the eukaryote Saccharomyces cerevisiae is becoming an even more appealing microbial host for production of amino acids and derivatives because of its superior molecular and physiological features, such as amenable to genetic engineering and high tolerance to harsh conditions. To transform S. cerevisiae into an industrial amino acid production platform, the highly coordinated and multiple layers regulation in its amino acid metabolism should be relieved and reconstituted to optimize the metabolic flux toward synthesis of target products. This chapter describes principles, strategies, and applications of modular pathway rewiring in yeast using the engineering of l-ornithine metabolism as a paradigm. Additionally, detailed protocols for in vitro module construction and CRISPR/Cas-mediated pathway assembly are provided.

RevDate: 2018-09-03

Schultz C, Lian J, H Zhao (2018)

Metabolic Engineering of Saccharomyces cerevisiae Using a Trifunctional CRISPR/Cas System for Simultaneous Gene Activation, Interference, and Deletion.

Methods in enzymology, 608:265-276.

Design and construction of an optimal microbial cell factory typically requires overexpression, knockdown, and knockout of multiple gene targets. In this chapter, we describe a combinatorial metabolic engineering strategy utilizing an orthogonal trifunctional CRISPR system that combines transcriptional activation, transcriptional interference, and gene deletion (CRISPR-AID) in the yeast Saccharomyces cerevisiae. This strategy enables multiplexed perturbation of the metabolic and regulatory networks in a modular, parallel, and high-throughput manner. To implement this system, three orthogonal Cas proteins were utilized: dLbCpf1 fused to a transcriptional activator, dSpCas9 fused to a transcriptional repressor, and SaCas9 for gene deletion. Deletion was accomplished by the introduction of a 28bp frame-shift mutation using a homology donor on the guide RNA expression vector. This approach enables the application of metabolic engineering to systematically optimize phenotypes of interest through a combination of gain-, reduction-, and loss-of-function mutations. Finally, we describe the construction of the CRISPR-AID system and its application toward engineering an example phenotype, surface display of recombinant Trichoderma reesei endoglucanase II.

RevDate: 2018-09-01

McGinn J, LA Marraffini (2018)

Molecular mechanisms of CRISPR-Cas spacer acquisition.

Nature reviews. Microbiology pii:10.1038/s41579-018-0071-7 [Epub ahead of print].

Many bacteria and archaea have the unique ability to heritably alter their genomes by incorporating small fragments of foreign DNA, called spacers, into CRISPR loci. Once transcribed and processed into individual CRISPR RNAs, spacer sequences guide Cas effector nucleases to destroy complementary, invading nucleic acids. Collectively, these two processes are known as the CRISPR-Cas immune response. In this Progress article, we review recent studies that have advanced our understanding of the molecular mechanisms underlying spacer acquisition and that have revealed a fundamental link between the two phases of CRISPR immunity that ensures optimal immunity from newly acquired spacers. Finally, we highlight important open questions and discuss the potential basic and applied impact of spacer acquisition research.

RevDate: 2018-09-08

Lee JH, Wang JH, Chen J, et al (2018)

Gene therapy for visual loss: Opportunities and concerns.

Progress in retinal and eye research pii:S1350-9462(18)30007-7 [Epub ahead of print].

Many clinical trials using gene therapy have shown significant therapeutic benefits and exceptional safety records. Increasing evidence is verifying the long sought-after promise that gene therapy will genetically 'cure' some severely disabling diseases. In particular, the first gene therapy bioproduct for RPE65-associated Leber's congenital amaurosis, which was approved by the US Food and Drug Administration in 2017, has provided tremendous encouragement to the field of gene therapy. Recent developments in genome editing technologies have significantly advanced our capability to precisely engineer genomes in eukaryotic cells. Programmable nucleases, particularly the CRISPR/Cas system, have been widely adopted in studies applying genome engineering therapy to ocular diseases with the hope of managing these diseases. In this review article, we summarize the current approaches that have been developed in the area of gene therapy for ocular disease. We also discuss the challenges and opportunities facing gene therapy for ocular diseases, as well as its prospects.

RevDate: 2018-10-06

Schuh RS, Poletto É, Pasqualim G, et al (2018)

In vivo genome editing of mucopolysaccharidosis I mice using the CRISPR/Cas9 system.

Journal of controlled release : official journal of the Controlled Release Society, 288:23-33.

Mucopolysaccharidosis type I (MPS I) is a multisystemic disorder caused by the deficiency of alpha-L-iduronidase (IDUA) that leads to intracellular accumulation of glycosaminoglycans (GAG). In the present study we aimed to use cationic liposomes carrying the CRISPR/Cas9 plasmid and a donor vector for in vitro and in vivo MPS I gene editing, and compare to treatment with naked plasmids. The liposomal formulation was prepared by microfluidization. Complexes were obtained by the addition of DNA at +4/-1 charge ratio. The overall results showed complexes of about 110 nm, with positive zeta potential of +30 mV. The incubation of the complexes with fibroblasts from MPS I patients led to a significant increase in IDUA activity and reduction of lysosomal abnormalities. Hydrodynamic injection of the liposomal complex in newborn MPS I mice led to a significant increase in serum IDUA levels for up to six months. The biodistribution of complexes after hydrodynamic injection was markedly detected in the lungs and heart, corroborating the results of increased IDUA activity and decreased GAG storage especially in these tissues, while the group that received the naked plasmids presented increased enzyme activity especially in the liver. Furthermore, animals treated with the liposomal formulation presented improvement in cardiovascular parameters, one of the main causes of death observed in MPS I patients. We conclude that the IDUA production in multiple organs had a significant beneficial effect on the characteristics of MPS I disease, which may bring hope to gene therapy of Hurler patients.

RevDate: 2018-09-06

Knott GJ, JA Doudna (2018)

CRISPR-Cas guides the future of genetic engineering.

Science (New York, N.Y.), 361(6405):866-869.

The diversity, modularity, and efficacy of CRISPR-Cas systems are driving a biotechnological revolution. RNA-guided Cas enzymes have been adopted as tools to manipulate the genomes of cultured cells, animals, and plants, accelerating the pace of fundamental research and enabling clinical and agricultural breakthroughs. We describe the basic mechanisms that set the CRISPR-Cas toolkit apart from other programmable gene-editing technologies, highlighting the diverse and naturally evolved systems now functionalized as biotechnologies. We discuss the rapidly evolving landscape of CRISPR-Cas applications, from gene editing to transcriptional regulation, imaging, and diagnostics. Continuing functional dissection and an expanding landscape of applications position CRISPR-Cas tools at the cutting edge of nucleic acid manipulation that is rewriting biology.

RevDate: 2018-10-17

Ždralević M, Brand A, Di Ianni L, et al (2018)

Double genetic disruption of lactate dehydrogenases A and B is required to ablate the "Warburg effect" restricting tumor growth to oxidative metabolism.

The Journal of biological chemistry, 293(41):15947-15961.

Increased glucose consumption distinguishes cancer cells from normal cells and is known as the "Warburg effect" because of increased glycolysis. Lactate dehydrogenase A (LDHA) is a key glycolytic enzyme, a hallmark of aggressive cancers, and believed to be the major enzyme responsible for pyruvate-to-lactate conversion. To elucidate its role in tumor growth, we disrupted both the LDHA and LDHB genes in two cancer cell lines (human colon adenocarcinoma and murine melanoma cells). Surprisingly, neither LDHA nor LDHB knockout strongly reduced lactate secretion. In contrast, double knockout (LDHA/B-DKO) fully suppressed LDH activity and lactate secretion. Furthermore, under normoxia, LDHA/B-DKO cells survived the genetic block by shifting their metabolism to oxidative phosphorylation (OXPHOS), entailing a 2-fold reduction in proliferation rates in vitro and in vivo compared with their WT counterparts. Under hypoxia (1% oxygen), however, LDHA/B suppression completely abolished in vitro growth, consistent with the reliance on OXPHOS. Interestingly, activation of the respiratory capacity operated by the LDHA/B-DKO genetic block as well as the resilient growth were not consequences of long-term adaptation. They could be reproduced pharmacologically by treating WT cells with an LDHA/B-specific inhibitor (GNE-140). These findings demonstrate that the Warburg effect is not only based on high LDHA expression, as both LDHA and LDHB need to be deleted to suppress fermentative glycolysis. Finally, we demonstrate that the Warburg effect is dispensable even in aggressive tumors and that the metabolic shift to OXPHOS caused by LDHA/B genetic disruptions is responsible for the tumors' escape and growth.

RevDate: 2018-10-03
CmpDate: 2018-09-28

Butt H, Jamil M, Wang JY, et al (2018)

Engineering plant architecture via CRISPR/Cas9-mediated alteration of strigolactone biosynthesis.

BMC plant biology, 18(1):174 pii:10.1186/s12870-018-1387-1.

BACKGROUND: Precision plant genome engineering holds much promise for targeted improvement of crop traits via unprecedented single-base level control over the genetic material. Strigolactones (SLs) are a key determinant of plant architecture, known for their role in inhibiting shoot branching (tillering).

RESULTS: We used CRISPR/Cas9 in rice (Oryza sativa) for targeted disruption of CAROTENOID CLEAVAGE DIOXYGENASE 7 (CCD7), which controls a key step in SL biosynthesis. The ccd7 mutants exhibited a striking increase in tillering, combined with a reduced height, which could be rescued by application of the synthetic SL analog GR24. Striga germination assays and liquid chromatography-mass spectrometry analysis showed that root exudates of ccd7 mutants were also SL deficient.

CONCLUSIONS: Taken together, our results show the potential and feasibility of the use of the CRISPR/Cas9 system for targeted engineering of plant architecture and for elucidating the molecular underpinnings of architecture-related traits.

RevDate: 2018-09-18

Nicholson TJ, Jackson SA, Croft BI, et al (2018)

Bioinformatic evidence of widespread priming in type I and II CRISPR-Cas systems.

RNA biology [Epub ahead of print].

CRISPR-Cas systems provide bacteria and archaea with adaptive immunity against invading genetic elements, such as plasmids, bacteriophages and archaeal viruses. They consist of cas genes and CRISPR loci, which store genetic memories of previously encountered invaders as short sequences termed spacers. Spacers determine the specificity of CRISPR-Cas defence and immunity can be gained or updated by the addition of new spacers into CRISPR loci. There are two main routes to spacer acquisition, which are known as naïve and primed CRISPR adaptation. Naïve CRISPR adaptation involves the de novo formation of immunity, independent of pre-existing spacers. In contrast, primed CRISPR adaptation (priming) uses existing spacers to enhance the acquisition of new spacers. Priming typically results in spacer acquisition from locations near the site of target recognition by the existing (priming) spacer. Primed CRISPR adaptation has been observed in several type I CRISPR-Cas systems and it is potentially widespread. However, experimental evidence is unavailable for some subtypes, and for most systems, priming has only been shown in a small number of hosts. There is also no current evidence of priming by other CRISPR-Cas types. Here, we used a bioinformatic approach to search for evidence of priming in diverse CRISPR-Cas systems. By analysing the clustering of spacers acquired from phages, prophages and archaeal viruses, including strand and directional biases between subsequently acquired spacers, we demonstrate that two patterns of primed CRISPR adaptation dominate in type I systems. In addition, we find evidence of a priming-like pathway in type II CRISPR-Cas systems.

RevDate: 2018-09-29

Aumann RA, Schetelig MF, I Häcker (2018)

Highly efficient genome editing by homology-directed repair using Cas9 protein in Ceratitis capitata.

Insect biochemistry and molecular biology, 101:85-93.

The Mediterranean fruit fly Ceratitis capitata is a highly polyphagous and invasive insect pest, causing enormous economic damage in horticultural systems. A successful and environment-friendly control strategy is the sterile insect technique (SIT) that reduces pest populations through infertile matings with mass-released, sterilized insects. However, the SIT is not readily applicable to each pest species. While transgenic approaches hold great promise to improve critical aspects of the SIT to transfer it to new species, they are suspect to strict or even prohibitive legislation regarding the release of genetically modified (GM) organisms. In contrast, specific mutations created via CRISPR-Cas genome editing are not regulated as GM in the US, and might thus allow creating optimal strains for SIT. Here, we describe highly efficient homology-directed repair genome editing in C. capitata by injecting pre-assembled CRISPR-Cas9 ribonucleoprotein complexes using different guide RNAs and a short single-stranded oligodeoxynucleotide donor to convert an enhanced green fluorescent protein in C. capitata into a blue fluorescent protein. Six out of seven fertile and individually backcrossed G0 individuals generated 57-90% knock-in rate within their total offspring and 70-96% knock-in rate within their phenotypically mutant offspring. Based on the achieved efficiency, this approach could also be used to introduce mutations which do not produce a screenable phenotype and identify positive mutants with a reasonable workload. Furthermore, CRISPR-Cas HDR would allow to recreate mutations formerly identified in classical mutagenesis screens and to transfer them to related species to establish new (SIT-like) pest control systems. Considering the potential that CRISPR-induced alterations in organisms could be classified as non-GM in additional countries, such new strains could potentially be used for pest control applications without the need to struggle with GMO directives.

RevDate: 2018-08-29

Maier JAH, A Jeltsch (2018)

Design and Application of 6mA-Specific Zinc-Finger Proteins for the Readout of DNA Methylation.

Methods in molecular biology (Clifton, N.J.), 1867:29-41.

Designed zinc-finger (ZnF) proteins can recognize AT base pairs by H-bonds in the major groove, which are disrupted, if the adenine base is methylated at the N6 position. Based on this principle, we have recently designed a ZnF protein, which does not bind to DNA, if its recognition site is methylated. In this review, we summarize the principles of the recognition of methylated DNA by proteins and describe the design steps starting with the initial bacterial two-hybrid screening of three-domain ZnF proteins that do not bind to CcrM methylated target sites, followed by their di- and tetramerization to improve binding affinity and specificity. One of the 6mA-specific ZnF proteins was used as repressor to generate a methylation-sensitive promoter/repressor system. This artificial promoter/repressor system was employed to regulate the expression of a CcrM DNA methyltransferase gene, thereby generating an epigenetic system with positive feedback, which can exist in two stable states, an off-state with unmethylated promoter, bound ZnF and repressed gene expression, and an on-state with methylated promoter and active gene expression. This system can memorize transient signals approaching bacterial cells and store the input in the form of DNA methylation patterns. More generally, the ability to bind to DNA in a methylation-dependent manner gives ZnF and TAL proteins an advantage over CRISPR/Cas as DNA-targeting device by allowing methylation-dependent genome or epigenome editing.

RevDate: 2018-09-14

Nickel L, Ulbricht A, Alkhnbashi OS, et al (2018)

Cross-cleavage activity of Cas6b in crRNA processing of two different CRISPR-Cas systems in Methanosarcina mazei Gö1.

RNA biology [Epub ahead of print].

The clustered regularly interspaced short palindromic repeat (CRISPR) system is a prokaryotic adaptive defense system against foreign nucleic acids. In the methanoarchaeon Methanosarcina mazei Gö1, two types of CRISPR-Cas systems are present (type I-B and type III-C). Both loci encode a Cas6 endonuclease, Cas6b-IB and Cas6b-IIIC, typically responsible for maturation of functional short CRISPR RNAs (crRNAs). To evaluate potential cross cleavage activity, we biochemically characterized both Cas6b proteins regarding their crRNA binding behavior and their ability to process pre-crRNA from the respective CRISPR array in vivo. Maturation of crRNA was studied in the respective single deletion mutants by northern blot and RNA-Seq analysis demonstrating that in vivo primarily Cas6b-IB is responsible for crRNA processing of both CRISPR arrays. Tentative protein level evidence for the translation of both Cas6b proteins under standard growth conditions was detected, arguing for different activities or a potential non-redundant role of Cas6b-IIIC within the cell. Conservation of both Cas6 endonucleases was observed in several other M. mazei isolates, though a wide variety was displayed. In general, repeat and leader sequence conservation revealed a close correlation in the M. mazei strains. The repeat sequences from both CRISPR arrays from M. mazei Gö1 contain the same sequence motif with differences only in two nucleotides. These data stand in contrast to all other analyzed M. mazei isolates, which have at least one additional CRISPR array with repeats belonging to another sequence motif. This conforms to the finding that Cas6b-IB is the crucial and functional endonuclease in M. mazei Gö1.

ABBREVIATIONS: sRNA: small RNA; crRNA: CRISPR RNA; pre-crRNAs: Precursor CRISPR RNA; CRISPR: clustered regularly interspaced short palindromic repeats; Cas: CRISPR associated; nt: nucleotide; RNP: ribonucleoprotein; RBS: ribosome binding site.

RevDate: 2018-08-28

Shaw WR, F Catteruccia (2018)

Vector biology meets disease control: using basic research to fight vector-borne diseases.

Nature microbiology pii:10.1038/s41564-018-0214-7 [Epub ahead of print].

Human pathogens that are transmitted by insects are a global problem, particularly those vectored by mosquitoes; for example, malaria parasites transmitted by Anopheles species, and viruses such as dengue, Zika and chikungunya that are carried by Aedes mosquitoes. Over the past 15 years, the prevalence of malaria has been substantially reduced and virus outbreaks have been contained by controlling mosquito vectors using insecticide-based approaches. However, disease control is now threatened by alarming rates of insecticide resistance in insect populations, prompting the need to develop a new generation of specific strategies that can reduce vector-mediated transmission. Here, we review how increased knowledge in insect biology and insect-pathogen interactions is stimulating new concepts and tools for vector control. We focus on strategies that either interfere with the development of pathogens within their vectors or directly impact insect survival, including enhancement of vector-mediated immune control, manipulation of the insect microbiome, or use of powerful new genetic tools such as CRISPR-Cas systems to edit vector genomes. Finally, we offer a perspective on the implementation hurdles as well as the knowledge gaps that must be filled in the coming years to safely realize the potential of these novel strategies to eliminate the scourge of vector-borne disease.

RevDate: 2018-10-17
CmpDate: 2018-10-17

Zhu F, Feng M, Sinha R, et al (2018)

Screening for genes that regulate the differentiation of human megakaryocytic lineage cells.

Proceedings of the National Academy of Sciences of the United States of America, 115(40):E9308-E9316.

Different combinations of transcription factors (TFs) function at each stage of hematopoiesis, leading to distinct expression patterns of lineage-specific genes. The identification of such regulators and their functions in hematopoiesis remain largely unresolved. In this study, we utilized screening approaches to study the transcriptional regulators of megakaryocyte progenitor (MkP) generation, a key step before platelet production. Promising candidate genes were generated from a microarray platform gene expression commons and individually manipulated in human hematopoietic stem and progenitor cells (HSPCs). Deletion of some of the candidate genes (the hit genes) by CRISPR/Cas9 led to decreased MkP generation during HSPC differentiation, while more MkPs were produced when some hit genes were overexpressed in HSPCs. We then demonstrated that overexpression of these genes can increase the frequency of mature megakaryocytic colonies by functional colony forming unit-megakaryocyte (CFU-Mk) assay and the release of platelets after in vitro maturation. Finally, we showed that the histone deacetylase inhibitors could also increase MkP differentiation, possibly by regulating some of the newly identified TFs. Therefore, identification of such regulators will advance the understanding of basic mechanisms of HSPC differentiation and conceivably enable the generation and maturation of megakaryocytes and platelets in vitro.

RevDate: 2018-10-04
CmpDate: 2018-10-04

Wang Z, Hardcastle TJ, Canto Pastor A, et al (2018)

A novel DCL2-dependent miRNA pathway in tomato affects susceptibility to RNA viruses.

Genes & development, 32(17-18):1155-1160.

Tomato Dicer-like2 (slDCL2) is a key component of resistance pathways against potato virus X (PVX) and tobacco mosaic virus (TMV). It is also required for production of endogenous small RNAs, including miR6026 and other noncanonical microRNAs (miRNAs). The slDCL2 mRNAs are targets of these slDCL2-dependent RNAs in a feedback loop that was disrupted by target mimic RNAs of miR6026. In lines expressing these RNAs, there was correspondingly enhanced resistance against PVX and TMV. These findings illustrate a novel miRNA pathway in plants and a crop protection strategy in which miRNA target mimicry elevates expression of defense-related mRNAs.

RevDate: 2018-09-14

Auster O, Globus R, Yosef I, et al (2018)

Optimizing DNA transduction by selection of mutations that evade bacterial defense systems.

RNA biology [Epub ahead of print].

We recently developed a platform where phage-transducing particles optimize DNA delivery to a wide range of hosts. Here, we use this platform to optimize DNA transduction into hosts that naturally restrict specific DNA sequences. We first show that a specific plasmid is restricted for transduction into a particular Salmonella strain. Using the platform, we select for a mutated plasmid that overcomes the restriction barrier. Insertion of the non-mutated sequence into a permissive plasmid restricts transduction. We further show that epigenetic modification enables the DNA to evade restriction by the putative defense system. Our results validate this straightforward genetic approach for optimization of DNA transduction into new hosts.

RevDate: 2018-09-14

Papathanasiou P, Erdmann S, Leon-Sobrino C, et al (2018)

Stable maintenance of the rudivirus SIRV3 in a carrier state in Sulfolobus islandicus despite activation of the CRISPR-Cas immune response by a second virus SMV1.

RNA biology [Epub ahead of print].

Carrier state viral infection constitutes an equilibrium state in which a limited fraction of a cellular population is infected while the remaining cells are transiently resistant to infection. This type of infection has been characterized for several bacteriophages but not, to date, for archaeal viruses. Here we demonstrate that the rudivirus SIRV3 can produce a host-dependent carrier state infection in the model crenarchaeon Sulfolobus. SIRV3 only infected a fraction of a Sulfolobus islandicus REY15A culture over several days during which host growth was unimpaired and no chromosomal DNA degradation was observed. CRISPR spacer acquisition from SIRV3 DNA was induced by coinfecting with the monocaudavirus SMV1 and it was coincident with increased transcript levels from subtype I-A adaptation and interference cas genes. However, this response did not significantly affect the carrier state infection of SIRV3 and both viruses were maintained in the culture over 12 days during which SIRV3 anti-CRISPR genes were shown to be expressed. Transcriptome and proteome analyses demonstrated that most SIRV3 genes were expressed at varying levels over time whereas SMV1 gene expression was generally low. The study yields insights into the basis for the stable infection of SIRV3 and the resistance to the different host CRISPR-Cas interference mechanisms. It also provides a rationale for the commonly observed coinfection of archaeal cells by different viruses in natural environments.

RevDate: 2018-10-04
CmpDate: 2018-10-03

Zuo CX, Bian XC, Yang ZL, et al (2018)

[Establishment of Cas9 stably expressed human hepatocellular carcinoma and cholangiocarcinoma cell lines].

Zhonghua zhong liu za zhi [Chinese journal of oncology], 40(8):572-579.

Objective: To facilitate using the CRISPR/Cas9 gene editing system in human liver and gallbladder cancer cells, we established Cas9 stably expressed human liver and gallbladder cancer cell lines, and validated the gene editing activity of Cas9. Methods: Human liver cancer cell lines (Huh7, PLC/PRF/5, HepG2, Hep3b, SK-HEP-1 and Li-7), human cholangiocarcinoma cells (RBE) and human gallbladder cancer cells (GBC-SD) were infected with 3 Cas9-expressing lentivirus vectors (pLv-EF1α-Cas9-Flag-Neo, pLv-EF1α-Cas9-Flag-Puro, Cas9m1.1), respectively, and Cas9 stably expressed colonies were screened and selected. We extracted the genomic DNA and protein, validated the stable expression of Cas9 by using genomic polymerase chain reaction (PCR) and western blot. Three of cell lines were further infected with Lv-EF1α-mCherry. Then mCherry positive cells were sorted by flow cytometry and infected with designed guide RNA (gRNA) vectors which targeted mCherry gene. Subsequently the gene editing activity of Cas9 was detected by genomic PCR, fluorescence microscopic observation and flow cytometry analysis. Results: One hundred Cas9-expressing human liver and gallbladder cancer cell lines were selected. Among them, 35 cell lines expressed Cas9-Neo, 25 expressed Cas9-puro, and 40 expressed mutant Cas9 (mCas9). We also established 3 cell lines with stable expression of mCherry (Huh7-mCas9-M, PLC/PRF/5-Cas9-M and SK-HEP-1-Cas9-M). The results of genomic PCR and sequencing showed that by lentiviral infection with 2 types of designed gRNA, the long fragment deletion of mCherry gene was found in these 3 cell lines. Moreover, mCherry(-)EGFP(+) cells infected with 2 types of gRNA were observed by fluorescence microscope. The results of flow cytometry showed that mCherry(-)EGFP(+) cells accounted from 0.3% to 93.6%. Conclusion: We successfully establish 100 human liver and gallbladder cancer cell lines with stable expression of Cas9 protein and validate their activities of gene editing.

RevDate: 2018-08-23

Ren C, Xu K, Segal DJ, et al (2018)

Strategies for the Enrichment and Selection of Genetically Modified Cells.

Trends in biotechnology pii:S0167-7799(18)30208-7 [Epub ahead of print].

Programmable artificial nucleases have transitioned over the past decade from ZFNs and TALENs to CRISPR/Cas systems, which have been ubiquitously used with great success to modify genomes. The efficiencies of knockout and knockin vary widely among distinct cell types and genomic loci and depend on the nuclease delivery and cleavage efficiencies. Moreover, genetically modified cells are almost phenotypically indistinguishable from normal counterparts, making screening and isolating positive cells rather challenging and time-consuming. To address this issue, we review several strategies for the enrichment and selection of genetically modified cells, including transfection-positive selection, nuclease-positive selection, genome-targeted positive selection, and knockin-positive selection, to provide a reference for future genome research and gene therapy studies.

RevDate: 2018-08-21

Nethery MA, R Barrangou (2018)

CRISPR Visualizer: rapid identification and visualization of CRISPR loci via an automated high-throughput processing pipeline.

RNA biology [Epub ahead of print].

A CRISPR locus, defined by an array of repeat and spacer elements, constitutes a genetic record of the ceaseless battle between bacteria and viruses, showcasing the genomic integration of spacers acquired from invasive DNA. In particular, iterative spacer acquisitions represent unique evolutionary histories and are often useful for high-resolution bacterial genotyping, including comparative analysis of closely related organisms, clonal lineages, and clinical isolates. Current spacer visualization methods are typically tedious and can require manual data manipulation and curation, including spacer extraction at each CRISPR locus from genomes of interest. Here, we constructed a high-throughput extraction pipeline coupled with a local web-based visualization tool which enables CRISPR spacer and repeat extraction, rapid visualization, graphical comparison, and progressive multiple sequence alignment. We present the bioinformatic pipeline and investigate the loci of reference CRISPR-Cas systems and model organisms in 4 well-characterized subtypes. We illustrate how this analysis uncovers the evolutionary tracks and homology shared between various organisms through visual comparison of CRISPR spacers and repeats, driven through progressive alignments. Due to the ability to process unannotated genome files with minimal preparation and curation, this pipeline can be implemented promptly. Overall, this efficient high-throughput solution supports accelerated analysis of genomic data sets and enables and expedites genotyping efforts based on CRISPR loci.

RevDate: 2018-09-17
CmpDate: 2018-09-17

Bachas C, Hodzic J, van der Mijn JC, et al (2018)

Rscreenorm: normalization of CRISPR and siRNA screen data for more reproducible hit selection.

BMC bioinformatics, 19(1):301 pii:10.1186/s12859-018-2306-z.

BACKGROUND: Reproducibility of hits from independent CRISPR or siRNA screens is poor. This is partly due to data normalization primarily addressing technical variability within independent screens, and not the technical differences between them.

RESULTS: We present "rscreenorm", a method that standardizes the functional data ranges between screens using assay controls, and subsequently performs a piecewise-linear normalization to make data distributions across all screens comparable. In simulation studies, rscreenorm reduces false positives. Using two multiple-cell lines siRNA screens, rscreenorm increased reproducibility between 27 and 62% for hits, and up to 5-fold for non-hits. Using publicly available CRISPR-Cas screen data, application of commonly used median centering yields merely 34% of overlapping hits, in contrast with rscreenorm yielding 84% of overlapping hits. Furthermore, rscreenorm yielded at most 8% discordant results, whilst median-centering yielded as much as 55%.

CONCLUSIONS: Rscreenorm yields more consistent results and keeps false positive rates under control, improving reproducibility of genetic screens data analysis from multiple cell lines.

RevDate: 2018-08-29

Argemi X, Matelska D, Ginalski K, et al (2018)

Comparative genomic analysis of Staphylococcus lugdunensis shows a closed pan-genome and multiple barriers to horizontal gene transfer.

BMC genomics, 19(1):621 pii:10.1186/s12864-018-4978-1.

BACKGROUND: Coagulase negative staphylococci (CoNS) are commensal bacteria on human skin. Staphylococcus lugdunensis is a unique CoNS which produces various virulence factors and may, like S. aureus, cause severe infections, particularly in hospital settings. Unlike other staphylococci, it remains highly susceptible to antimicrobials, and genome-based phylogenetic studies have evidenced a highly conserved genome that distinguishes it from all other staphylococci.

RESULTS: We demonstrate that S. lugdunensis possesses a closed pan-genome with a very limited number of new genes, in contrast to other staphylococci that have an open pan-genome. Whole-genome nucleotide and amino acid identity levels are also higher than in other staphylococci. We identified numerous genetic barriers to horizontal gene transfer that might explain this result. The S. lugdunensis genome has multiple operons encoding for restriction-modification, CRISPR/Cas and toxin/antitoxin systems. We also identified a new PIN-like domain-associated protein that might belong to a larger operon, comprising a metalloprotease, that could function as a new toxin/antitoxin or detoxification system.

CONCLUSION: We show that S. lugdunensis has a unique genome profile within staphylococci, with a closed pan-genome and several systems to prevent horizontal gene transfer. Its virulence in clinical settings does not rely on its ability to acquire and exchange antibiotic resistance genes or other virulence factors as shown for other staphylococci.

RevDate: 2018-10-09
CmpDate: 2018-10-09

Xu L, Gao Y, Lau YS, et al (2018)

Adeno-Associated Virus-Mediated Delivery of CRISPR for Cardiac Gene Editing in Mice.

Journal of visualized experiments : JoVE.

The clustered, regularly interspaced, short, palindromic repeat (CRISPR) system has greatly facilitated genome engineering in both cultured cells and living organisms from a wide variety of species. The CRISPR technology has also been explored as novel therapeutics for a number of human diseases. Proof-of-concept data are highly encouraging as exemplified by recent studies that demonstrate the feasibility and efficacy of gene editing-based therapeutic approach for Duchenne muscular dystrophy (DMD) using a murine model. In particular, intravenous and intraperitoneal injection of the recombinant adeno-associated virus (rAAV) serotype rh.74 (rAAVrh.74) has enabled efficient cardiac delivery of the Staphylococcus aureus CRISPR-associated protein 9 (SaCas9) and two guide RNAs (gRNA) to delete a genomic region with a mutant codon in exon 23 of mouse Dmd gene. This same approach can also be used to knock out the gene-of-interest and study their cardiac function in postnatal mice when the gRNA is designed to target the coding region of the gene. In this protocol, we show in detail how to engineer rAAVrh.74-CRISPR vector and how to achieve highly efficient cardiac delivery in neonatal mice.

RevDate: 2018-08-22

Li J, Xu Z, Chupalov A, et al (2018)

Anti-CRISPR-based biosensors in the yeast S. cerevisiae.

Journal of biological engineering, 12:11 pii:101.

Background: Anti-CRISPR proteins are expressed by phages as a reaction to the bacterial CRISPR-Cas defense system. Recently, the structures of anti-CRISPR proteins have been determined, and their diverse functions have been clarified. Anti-CRISPR proteins such as LmAcrIIA2 and LmAcrIIA4 interact with the SpCas9:gRNA system and occlude the protospacer adjacent motif (PAM) recognition site, thereby preventing SpCas9:gRNA from binding to the DNA. Hence, anti-CRISPR proteins represent a powerful means to control and modulate the activity of SpCas9 and its nuclease-deficient version dSpCas9. LmAcrIIA2 and LmAcrIIA4 have been shown to be efficient inhibitors of SpCas9 in Escherichia coli, Saccharomyces cerevisiae, and mammalian cells. To date, there have been no reports of anti-CRISPR-based synthetic gene circuits engineered into yeast cells.

Results: We constructed in the yeast S. cerevisiae synthetic biosensors based on the anti-CRISPR-dSpCas9:gRNA interaction. Upon induction with galactose or β-estradiol, anti-CRISPR proteins (LmAcrIIA4, LmAcrIIA2, and StAcrIIA5) produced an enhancement in fluorescence expression by preventing the dSpCas9-Mxi1:gRNA complex from binding to the DNA. We found that LmAcrIIA2 performed as well as LmAcrIIA4 in S. cerevisiae, whereas StAcrIIA5, which had previously been tested in bacteria only, had non-negligible negative effects on yeast cell growth. The efficiency of anti-CRISPR-based biosensors was strongly dependent on the means by which the guide RNAs were produced. The best performance, as measured by the increase in fluorescence, was achieved using a "ribozyme-gRNA-ribozyme" expression cassette under the control of the yeast constitutive ADH1 promoter.

Conclusions: This work demonstrates that anti-CRISPR proteins are effective dSpCas9 suppressors in yeast cells. In particular, LmAcrIIA2 and LmAcrIIA4 could be employed as new components of yeast synthetic gene circuits.

RevDate: 2018-09-07

Meeske AJ, LA Marraffini (2018)

RNA Guide Complementarity Prevents Self-Targeting in Type VI CRISPR Systems.

Molecular cell, 71(5):791-801.e3.

All immune systems use precise target recognition to interrogate foreign invaders. During CRISPR-Cas immunity, prokaryotes capture short spacer sequences from infecting viruses and insert them into the CRISPR array. Transcription and processing of the CRISPR locus generate small RNAs containing the spacer and repeat sequences that guide Cas nucleases to cleave a complementary protospacer in the invading nucleic acids. In most CRISPR systems, sequences flanking the protospacer drastically affect cleavage. Here, we investigated the target requirements of the recently discovered RNA-targeting type VI-A CRISPR-Cas system in its natural host, Listeria seeligeri. We discovered that target RNAs with extended complementarity between the protospacer flanking sequence and the repeat sequence of the guide RNA are not cleaved by the type VI-A nuclease Cas13, neither in vivo nor in vitro. These findings establish fundamental rules for the design of Cas13-based technologies and provide a mechanism for preventing self-targeting in type VI-A systems.

RevDate: 2018-10-12

Qi X, Zhu L, Yang B, et al (2018)

Mitigation of cell apoptosis induced by ochratoxin A (OTA) is possibly through organic cation transport 2 (OCT2) knockout.

Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association, 121:15-23 pii:S0278-6915(18)30582-9 [Epub ahead of print].

Ochratoxin A (OTA) is a secondary metabolite of fungi such as Aspergillus ochraceus, A. niger and A. carbonarius, Penicillium verrucosum, and various other Penicillium, Petromyces, and Neopetromyces species. Various foods can be contaminated with OTA, potentially causing several toxic effects such as nephrotoxicity, hepatotoxicity and neurotoxicity. Typically, OTA is excreted by organic anion transporters (OATs). There is no research indicating organic cation transporters (OCTs) are involved in OTA nephrotoxicity. In our study, NRK-52E cells and rats were treated with OTA. OTA changed the expression of OCT1, OCT2 and OCT3 in NRK-52E cells and rat kidneys. TEA alleviated OTA-induced cell death, apoptosis, and DNA damage, and increased ROS. The OCT2 knockout cell line was constructed by the CRISPR/Cas 9 system. OCT2 knockout did not change the gene expression of OCT1, OAT1 and OAT3. OCT2 knockout alleviated the increase of Caspase 3 and CDK1 induced by OTA, leading to a reduction of apoptosis. In addition, OCT2 overexpression increased cell toxicity and expression of Caspase 3. In short, our findings indicate that OCT2 knockout possibly mitigate OTA-induced apoptosis by preventing the increase of Caspase 3 and CDK1.

RevDate: 2018-08-17

Huang YQ, Li GL, Yang HQ, et al (2018)

[Progress and application of genome-edited pigs in biomedical research].

Yi chuan = Hereditas, 40(8):632-646.

Genome editing technologies (GETs) can precisely alter the genomic sequences and modify the genetic information at the target site of an organism. Since the beginning of the 21st century, the GETs, including zinc finger nucleases (ZFN), transcription-activating-like receptor factor (TALEN), and clustered regularly interspaced short palindromic repeats/Cas endonucleases (CRISPR/Cas), have been successively developed. The GETs can easily engineer the targeted genomic site of animals to exhibit a desired phenotype(s), thereby providing valuable tools in biomedical research. The pigs are closely related to human, in terms of similarities in physiological properties and pathogenic characters. Thus, pigs have been used as important animal models in studies of human disease, xenotransplantation, and humanized organs regeneration. In this review, we summarize the development of the three GETs, research progress of genome-edited pigs as disease models and organ donors for xenotransplantation, and the prospects of their applications in future biomedical research.

RevDate: 2018-10-17

Cabello-Yeves PJ, Picazo A, Camacho A, et al (2018)

Ecological and genomic features of two widespread freshwater picocyanobacteria.

Environmental microbiology, 20(10):3757-3771.

We present two genomes of widespread freshwater picocyanobacteria isolated by extinction dilution from a Spanish oligotrophic reservoir. Based on microscopy and genomic properties, both picocyanobacteria were tentatively designated Synechococcus lacustris Tous, formerly described as a metagenome assembled genome (MAG) from the same habitat, and Cyanobium usitatum Tous, described here for the first time. Both strains were purified in unicyanobacterial cultures, and their genomes were sequenced. They are broadly distributed in freshwater systems; the first seems to be a specialist on temperate reservoirs (Tous, Amadorio, Dexter, Lake Lanier, Sparkling), and the second appears to also be abundant in cold environments including ice-covered lakes such as Lake Baikal, Lake Erie or the brackish Baltic Sea. Having complete genomes provided access to the flexible genome that does not assemble in MAGs. We found several genomic islands in both genomes, within which there were genes for nitrogen acquisition, transporters for a wide set of compounds and biosynthesis of phycobilisomes in both strains. Some of these regions of low coverage in metagenomes also included antimicrobial compounds, transposases and phage defence systems, including a novel type III CRISPR-Cas phage defence system that was only detected in Synechococcus lacustris Tous.

RevDate: 2018-10-15

Gordon-Lipkin E, A Fatemi (2018)

Current Therapeutic Approaches in Leukodystrophies: A Review.

Journal of child neurology, 33(13):861-868.

Leukodystrophies are a heterogeneous class of genetic diseases affecting the white matter in the central nervous system with a broad range of clinical manifestations and a frequently progressive course. An interest in precision medicine has emerged over the last several decades, and biomedical research in leukodystrophies has made exciting advances along this front through therapeutic target discovery and novel disease model systems. In this review, we discuss current and emerging therapeutic approaches in leukodystrophies, including gene therapy, antisense oligonucleotide therapy, CRISPR/CAS-based gene editing, and cell and stem cell based therapies.

RevDate: 2018-09-18

Gleditzsch D, Pausch P, Müller-Esparza H, et al (2018)

PAM identification by CRISPR-Cas effector complexes: diversified mechanisms and structures.

RNA biology [Epub ahead of print].

Adaptive immunity of prokaryotes is mediated by CRISPR-Cas systems that employ a large variety of Cas protein effectors to identify and destroy foreign genetic material. The different targeting mechanisms of Cas proteins rely on the proper protection of the host genome sequence while allowing for efficient detection of target sequences, termed protospacers. A short DNA sequence, the protospacer-adjacent motif (PAM), is frequently used to mark proper target sites. Cas proteins have evolved a multitude of PAM-interacting domains, which enables them to cope with viral anti-CRISPR measures that alter the sequence or accessibility of PAM elements. In this review, we summarize known PAM recognition strategies for all CRISPR-Cas types. Available structures of target bound Cas protein effector complexes highlight the diversity of mechanisms and domain architectures that are employed to guarantee target specificity.

RevDate: 2018-08-17

Maikova A, Severinov K, O Soutourina (2018)

New Insights Into Functions and Possible Applications of Clostridium difficile CRISPR-Cas System.

Frontiers in microbiology, 9:1740.

Over the last decades the enteric bacterium Clostridium difficile (novel name Clostridioides difficile) - has emerged as an important human nosocomial pathogen. It is a leading cause of hospital-acquired diarrhea and represents a major challenge for healthcare providers. Many aspects of C. difficile pathogenesis and its evolution remain poorly understood. Efficient defense systems against phages and other genetic elements could have contributed to the success of this enteropathogen in the phage-rich gut communities. Recent studies demonstrated the presence of an active CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-associated) subtype I-B system in C. difficile. In this mini-review, we will discuss the recent advances in characterization of original features of the C. difficile CRISPR-Cas system in laboratory and clinical strains, as well as interesting perspectives for our understanding of this defense system function and regulation in this important enteropathogen. This knowledge will pave the way for the development of promising biotechnological and therapeutic tools in the future. Possible applications for the C. difficile strain monitoring and genotyping, as well as for CRISPR-based genome editing and antimicrobials are also discussed.

RevDate: 2018-08-14

Künne T, Zhu Y, da Silva F, et al (2018)

Role of nucleotide identity in effective CRISPR target escape mutations.

Nucleic acids research pii:5070486 [Epub ahead of print].

Prokaryotes use primed CRISPR adaptation to update their memory bank of spacers against invading genetic elements that have escaped CRISPR interference through mutations in their protospacer target site. We previously observed a trend that nucleotide-dependent mismatches between crRNA and the protospacer strongly influence the efficiency of primed CRISPR adaptation. Here we show that guanine-substitutions in the target strand of the protospacer are highly detrimental to CRISPR interference and interference-dependent priming, while cytosine-substitutions are more readily tolerated. Furthermore, we show that this effect is based on strongly decreased binding affinity of the effector complex Cascade for guanine-mismatched targets, while cytosine-mismatched targets only minimally affect target DNA binding. Structural modeling of Cascade-bound targets with mismatches shows that steric clashes of mismatched guanines lead to unfavorable conformations of the RNA-DNA duplex. This effect has strong implications for the natural selection of target site mutations that lead to effective escape from type I CRISPR-Cas systems.

RevDate: 2018-08-14

Molenda O, Tang S, Lomheim L, et al (2018)

Extrachromosomal circular elements targeted by CRISPR-Cas in Dehalococcoides mccartyi are linked to mobilization of reductive dehalogenase genes.

The ISME journal pii:10.1038/s41396-018-0254-2 [Epub ahead of print].

Dehalococcoides mccartyi are obligate organohalide-respiring bacteria that play an important detoxifying role in the environment. They have small genomes (~1.4 Mb) with a core region interrupted by two high plasticity regions (HPRs) containing dozens of genes encoding reductive dehalogenases involved in organohalide respiration. The genomes of eight new strains of D. mccartyi were closed from metagenomic data from a related set of enrichment cultures, bringing the total number of genomes to 24. Two of the newly sequenced strains and three previously sequenced strains contain CRISPR-Cas systems. These D. mccartyi CRISPR-Cas systems were found to primarily target prophages and genomic islands. The genomic islands were identified either as integrated into D. mccartyi genomes or as circular extrachromosomal elements. We observed active circularization of the integrated genomic island containing vcrABC operon encoding the dehalogenase (VcrA) responsible for the transformation of vinyl chloride to non-toxic ethene. We interrogated archived DNA from established enrichment cultures and found that the CRISPR array acquired three new spacers in 11 years. These data provide a glimpse into dynamic processes operating on the genomes distinct to D. mccartyi strains found in enrichment cultures and provide the first insights into possible mechanisms of lateral DNA exchange in D. mccartyi.

RevDate: 2018-10-04
CmpDate: 2018-10-02

Zhang Z, Niu B, Ji D, et al (2018)

Silkworm genetic sexing through W chromosome-linked, targeted gene integration.

Proceedings of the National Academy of Sciences of the United States of America, 115(35):8752-8756.

Sex separation methods are critical for genetic sexing systems in commercial insect production and sterile insect techniques. Integration of selectable marker genes into a sex chromosome is particularly useful in insects with a heterogametic sex determination system. Here, we describe targeted gene integration of fluorescent marker expression cassettes into a randomly amplified polymorphic DNA (RAPD) marker region in the W chromosome of the lepidopteran model insect Bombyx mori using transcriptional activator-like effector nuclease (TALEN)-mediated genome editing. This silkworm strain shows ubiquitous female-specific red or green fluorescence from the embryonic to adult stages. Furthermore, we developed a binary, female-specific, embryonic lethality system combining the TALEN and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) technology. This system includes one strain with TALEN-mediated, W-specific Cas9 expression driven by the silkworm germ cell-specific nanos (nos) promoter and another strain with U6-derived single-guide RNA (sgRNA) expression targeting transformer 2 (tra2), an essential gene for silkworm embryonic development. Filial 1 (F1) hybrids exhibit complete female-specific lethality during embryonic stages. Our study provides a promising approach for B. mori genetic sexing and sheds light on developing sterile insect techniques in other insect species, especially in lepidopteran pests with WZ/ZZ sex chromosome systems.

RevDate: 2018-09-27

Devkota S (2018)

The road less traveled: strategies to enhance the frequency of homology-directed repair (HDR) for increased efficiency of CRISPR/Cas-mediated transgenesis.

BMB reports, 51(9):437-443.

Non-homologous end joining (NHEJ), and to a lesser extent, the error-free pathway known as homology-directed repair (HDR) are cellular mechanisms for recovery from double-strand DNA breaks (DSB) induced by RNA-guided programmable nuclease CRISPR/Cas. Since NHEJ is equivalent to using a duck tape to stick two pieces of metals together, the outcome of this repair mechanism is prone to error. Any out-of-frame mutations or premature stop codons resulting from NHEJ repair mechanism are extremely handy for loss-of-function studies. Substitution of a mutation on the genome with the correct exogenous repair DNA requires coordination via an error-free HDR, for targeted transgenesis. However, several practical limitations exist in harnessing the potential of HDR to replace a faulty mutation for therapeutic purposes in all cell types and more so in somatic cells. In germ cells after the DSB, copying occurs from the homologous chromosome, which increases the chances of incorporation of exogenous DNA with some degree of homology into the genome compared with somatic cells where copying from the identical sister chromatid is always preferred. This review summarizes several strategies that have been implemented to increase the frequency of HDR with a focus on somatic cells. It also highlights the limitations of this technology in gene therapy and suggests specific solutions to circumvent those barriers. [BMB Reports 2018; 51(9): 437-443].

RevDate: 2018-08-14

Faure G, Shmakov SA, Makarova KS, et al (2018)

Comparative genomics and evolution of trans-activating RNAs in Class 2 CRISPR-Cas systems.

RNA biology [Epub ahead of print].

Trans-activating CRISPR (tracr) RNA is a distinct RNA species that interacts with the CRISPR (cr) RNA to form the dual guide (g) RNA in type II and subtype V-B CRISPR-Cas systems. The tracrRNA-crRNA interaction is essential for pre-crRNA processing as well as target recognition and cleavage. The tracrRNA consists of an antirepeat, which forms an imperfect hybrid with the repeat in the crRNA, and a distal region containing a Rho-independent terminator. Exhaustive comparative analysis of the sequences and predicted structures of the Class 2 CRISPR guide RNAs shows that all these guide RNAs share distinct structural features, in particular, the nexus stem-loop that separates the repeat-antirepeat hybrid from the distal portion of the tracrRNA and the conserved GU pair at that end of the hybrid. These structural constraints might ensure full exposure of the spacer for target recognition. Reconstruction of tracrRNA evolution for 4 tight bacterial groups demonstrates random drift of repeat-antirepeat complementarity within a window of hybrid stability that is, apparently, maintained by selection. An evolutionary scenario is proposed whereby tracrRNAs evolved on multiple occasions, via rearrangement of a CRISPR array to form the antirepeat in different locations with respect to the array. A functional tracrRNA would form if, in the new location, the antirepeat is flanked by sequences that meet the minimal requirements for a promoter and a Rho-independent terminator. Alternatively, or additionally, the antirepeat sequence could be occasionally 'reset' by recombination with a repeat, restoring the functionality of tracrRNAs that drift beyond the required minimal hybrid stability.

RevDate: 2018-10-12

Ka D, Jang DM, Han BW, et al (2018)

Molecular organization of the type II-A CRISPR adaptation module and its interaction with Cas9 via Csn2.

Nucleic acids research, 46(18):9805-9815.

Clustered regularly interspaced short palindromic repeats (CRISPRs) and CRISPR-associated (Cas) proteins provide microbial adaptive immunity against invading foreign nucleic acids. In type II-A CRISPR-Cas systems, the Cas1-Cas2 integrase complex and the subtype-specific Csn2 comprise the CRISPR adaptation module, which cooperates with the Cas9 nuclease effector for spacer selection. Here, we report the molecular organization of the Streptococcus pyogenes type II-A CRISPR adaptation module and its interaction with Cas9 via Csn2. We determined the crystal structure of S. pyogenes type II-A Cas2. Chromatographic and calorimetric analyses revealed the stoichiometry and topology of the type II-A adaptation module composed of Cas1, Cas2 and Csn2. We also demonstrated that Cas9 interacts with Csn2 in a direct and stoichiometric manner. Our results reveal a network of molecular interactions among type II-A Cas proteins and highlight the role of Csn2 in coordinating Cas components involved in the adaptation and interference stages of CRISPR-mediated immunity.

LOAD NEXT 100 CITATIONS

ESP Quick Facts

ESP Origins

In the early 1990's, Robert Robbins was a faculty member at Johns Hopkins, where he directed the informatics core of GDB — the human gene-mapping database of the international human genome project. To share papers with colleagues around the world, he set up a small paper-sharing section on his personal web page. This small project evolved into The Electronic Scholarly Publishing Project.

ESP Support

In 1995, Robbins became the VP/IT of the Fred Hutchinson Cancer Research Center in Seattle, WA. Soon after arriving in Seattle, Robbins secured funding, through the ELSI component of the US Human Genome Project, to create the original ESP.ORG web site, with the formal goal of providing free, world-wide access to the literature of classical genetics.

ESP Rationale

Although the methods of molecular biology can seem almost magical to the uninitiated, the original techniques of classical genetics are readily appreciated by one and all: cross individuals that differ in some inherited trait, collect all of the progeny, score their attributes, and propose mechanisms to explain the patterns of inheritance observed.

ESP Goal

In reading the early works of classical genetics, one is drawn, almost inexorably, into ever more complex models, until molecular explanations begin to seem both necessary and natural. At that point, the tools for understanding genome research are at hand. Assisting readers reach this point was the original goal of The Electronic Scholarly Publishing Project.

ESP Usage

Usage of the site grew rapidly and has remained high. Faculty began to use the site for their assigned readings. Other on-line publishers, ranging from The New York Times to Nature referenced ESP materials in their own publications. Nobel laureates (e.g., Joshua Lederberg) regularly used the site and even wrote to suggest changes and improvements.

ESP Content

When the site began, no journals were making their early content available in digital format. As a result, ESP was obliged to digitize classic literature before it could be made available. For many important papers — such as Mendel's original paper or the first genetic map — ESP had to produce entirely new typeset versions of the works, if they were to be available in a high-quality format.

ESP Help

Early support from the DOE component of the Human Genome Project was critically important for getting the ESP project on a firm foundation. Since that funding ended (nearly 20 years ago), the project has been operated as a purely volunteer effort. Anyone wishing to assist in these efforts should send an email to Robbins.

ESP Plans

With the development of methods for adding typeset side notes to PDF files, the ESP project now plans to add annotated versions of some classical papers to its holdings. We also plan to add new reference and pedagogical material. We have already started providing regularly updated, comprehensive bibliographies to the ESP.ORG site.

Click Covers to Order from Amazon

CRISPR-Cas

By delivering the Cas9 nuclease, complexed with a synthetic guide RNA (gRNA) into a cell, the cell's genome can be precisely cut at any desired location, allowing existing genes to be removed and/or new ones added. That is, the CRISPR-Cas system provides a tool for the cut-and-paste editing of genomes. Welcome to the brave new world of genome editing. R. Robbins

Electronic Scholarly Publishing
21454 NE 143rd Street
Woodinville, WA 98077

E-mail: RJR8222 @ gmail.com

Papers in Classical Genetics

The ESP began as an effort to share a handful of key papers from the early days of classical genetics. Now the collection has grown to include hundreds of papers, in full-text format.

Digital Books

Along with papers on classical genetics, ESP offers a collection of full-text digital books, including many works by Darwin (and even a collection of poetry — Chicago Poems by Carl Sandburg).

Timelines

ESP now offers a much improved and expanded collection of timelines, designed to give the user choice over subject matter and dates.

Biographies

Biographical information about many key scientists.

Selected Bibliographies

Bibliographies on several topics of potential interest to the ESP community are now being automatically maintained and generated on the ESP site.

ESP Picks from Around the Web (updated 07 JUL 2018 )