Viewport Size Code:
Login | Create New Account
picture

  MENU

About | Classical Genetics | Timelines | What's New | What's Hot

About | Classical Genetics | Timelines | What's New | What's Hot

icon

Bibliography Options Menu

icon
QUERY RUN:
HITS:
PAGE OPTIONS:
Hide Abstracts   |   Hide Additional Links
NOTE:
Long bibliographies are displayed in blocks of 100 citations at a time. At the end of each block there is an option to load the next block.

Bibliography on: CRISPR-Cas

The Electronic Scholarly Publishing Project: Providing world-wide, free access to classic scientific papers and other scholarly materials, since 1993.

More About:  ESP | OUR CONTENT | THIS WEBSITE | WHAT'S NEW | WHAT'S HOT

ESP: PubMed Auto Bibliography 10 Dec 2018 at 01:31 Created: 

CRISPR-Cas

Clustered regularly interspaced short palindromic repeats (CRISPR, pronounced crisper) are segments of prokaryotic DNA containing short repetitions of base sequences. Each repetition is followed by short segments of "spacer DNA" from previous exposures to foreign DNA (e.g a virus or plasmid). The CRISPR/Cas system is a prokaryotic immune system that confers resistance to foreign genetic elements such as those present within plasmids and phages, and provides a form of acquired immunity. CRISPR associated proteins (Cas) use the CRISPR spacers to recognize and cut these exogenous genetic elements in a manner analogous to RNA interference in eukaryotic organisms. CRISPRs are found in approximately 40% of sequenced bacterial genomes and 90% of sequenced archaea. By delivering the Cas9 nuclease complexed with a synthetic guide RNA (gRNA) into a cell, the cell's genome can be cut at a desired location, allowing existing genes to be removed and/or new ones added. The Cas9-gRNA complex corresponds with the CAS III crRNA complex in the above diagram. CRISPR/Cas genome editing techniques have many potential applications, including altering the germline of humans, animals, and food crops. The use of CRISPR Cas9-gRNA complex for genome editing was the AAAS's choice for breakthrough of the year in 2015.

Created with PubMed® Query: "CRISPR.CAS" OR "crispr/cas" NOT pmcbook NOT ispreviousversion

Citations The Papers (from PubMed®)

RevDate: 2018-12-06

Toymentseva AA, J Altenbuchner (2018)

New CRISPR-Cas9 vectors for genetic modifications of Bacillus species.

FEMS microbiology letters pii:5232309 [Epub ahead of print].

Genetic manipulation is a fundamental procedure for the study of gene and operon functions and new characteristics acquisition. Modern CRISPR-Cas technology allows genome editing more precise and increases the efficiency of transferring mutations in a variety of hard to manipulate organisms. Here, we describe new CRISPR-Cas vectors for genetic modifications in bacillary species. Our plasmids are single CRISPR-Cas plasmids comprising all components for genome editing and should be functional in a broad host range. They are highly efficient (up to 97%) and precise. The employment and delivery of these plasmids to bacillary strains can be easily achieved by conjugation from E. coli. During our research we also demonstrated the absence of compatibility between CRISPR-Cas system and NHEJ in B. subtilis.

RevDate: 2018-12-06

Zhou Q, Zhan H, Liao X, et al (2018)

A revolutionary tool: CRISPR technology plays an important role in construction of intelligentized gene circuits.

Cell proliferation [Epub ahead of print].

With the development of synthetic biology, synthetic gene circuits have shown great applied potential in medicine, biology, and as commodity chemicals. An ultimate challenge in the construction of gene circuits is the lack of effective, programmable, secure and sequence-specific gene editing tools. The clustered regularly interspaced short palindromic repeat (CRISPR) system, a CRISPR-associated RNA-guided endonuclease Cas9 (CRISPR-associated protein 9)-targeted genome editing tool, has recently been applied in engineering gene circuits for its unique properties-operability, high efficiency and programmability. The traditional single-targeted therapy cannot effectively distinguish tumour cells from normal cells, and gene therapy for single targets has poor anti-tumour effects, which severely limits the application of gene therapy. Currently, the design of gene circuits using tumour-specific targets based on CRISPR/Cas systems provides a new way for precision cancer therapy. Hence, the application of intelligentized gene circuits based on CRISPR technology effectively guarantees the safety, efficiency and specificity of cancer therapy. Here, we assessed the use of synthetic gene circuits and if the CRISPR system could be used, especially artificial switch-inducible Cas9, to more effectively target and treat tumour cells. Moreover, we also discussed recent advances, prospectives and underlying challenges in CRISPR-based gene circuit development.

RevDate: 2018-12-06

Ayabe S, Nakashima K, A Yoshiki (2018)

Off- and on-target effects of genome editing in mouse embryos.

The Journal of reproduction and development [Epub ahead of print].

Clustered regularly interspaced short palindromic repeats (CRISPR)-Cas-based genome editing technology has enabled manipulation of the embryonic genome. Unbiased whole genome sequencing comparing parents to progeny has revealed that the rate of Cas9-induced mutagenesis in mouse embryos is indistinguishable from the background rate of de novo mutation. However, establishing the best practice to confirm on-target alleles of interest remains a challenge. We believe that improvement in editing strategies and screening methods for founder mice will contribute to the generation of quality-controlled animals, thereby ensuring reproducibility of results in animal studies and advancing the 3Rs (replacement, reduction, and refinement).

RevDate: 2018-12-03

Wang L, Mo CY, Wasserman MR, et al (2018)

Dynamics of Cas10 Govern Discrimination between Self and Non-self in Type III CRISPR-Cas Immunity.

Molecular cell pii:S1097-2765(18)30978-X [Epub ahead of print].

Adaptive immune systems must accurately distinguish between self and non-self in order to defend against invading pathogens while avoiding autoimmunity. Type III CRISPR-Cas systems employ guide RNA to recognize complementary RNA targets, which triggers the degradation of both the invader's transcripts and their template DNA. These systems can broadly eliminate foreign targets with multiple mutations but circumvent damage to the host genome. To explore the molecular basis for these features, we use single-molecule fluorescence microscopy to study the interaction between a type III-A ribonucleoprotein complex and various RNA substrates. We find that Cas10-the DNase effector of the complex-displays rapid conformational fluctuations on foreign RNA targets, but is locked in a static configuration on self RNA. Target mutations differentially modulate Cas10 dynamics and tune the CRISPR interference activity in vivo. These findings highlight the central role of the internal dynamics of CRISPR-Cas complexes in self versus non-self discrimination and target specificity.

RevDate: 2018-12-03

Jia N, Mo CY, Wang C, et al (2018)

Type III-A CRISPR-Cas Csm Complexes: Assembly, Periodic RNA Cleavage, DNase Activity Regulation, and Autoimmunity.

Molecular cell pii:S1097-2765(18)30977-8 [Epub ahead of print].

Type ΙΙΙ CRISPR-Cas systems provide robust immunity against foreign RNA and DNA by sequence-specific RNase and target RNA-activated sequence-nonspecific DNase and RNase activities. We report on cryo-EM structures of Thermococcus onnurineus CsmcrRNA binary, CsmcrRNA-target RNA and CsmcrRNA-target RNAanti-tag ternary complexes in the 3.1 Å range. The topological features of the crRNA 5'-repeat tag explains the 5'-ruler mechanism for defining target cleavage sites, with accessibility of positions -2 to -5 within the 5'-repeat serving as sensors for avoidance of autoimmunity. The Csm3 thumb elements introduce periodic kinks in the crRNA-target RNA duplex, facilitating cleavage of the target RNA with 6-nt periodicity. Key Glu residues within a Csm1 loop segment of CsmcrRNA adopt a proposed autoinhibitory conformation suggestive of DNase activity regulation. These structural findings, complemented by mutational studies of key intermolecular contacts, provide insights into CsmcrRNA complex assembly, mechanisms underlying RNA targeting and site-specific periodic cleavage, regulation of DNase cleavage activity, and autoimmunity suppression.

RevDate: 2018-12-03

You L, Ma J, Wang J, et al (2018)

Structure Studies of the CRISPR-Csm Complex Reveal Mechanism of Co-transcriptional Interference.

Cell pii:S0092-8674(18)31451-X [Epub ahead of print].

Csm, a type III-A CRISPR-Cas interference complex, is a CRISPR RNA (crRNA)-guided RNase that also possesses target RNA-dependent DNase and cyclic oligoadenylate (cOA) synthetase activities. However, the structural features allowing target RNA-binding-dependent activation of DNA cleavage and cOA generation remain unknown. Here, we report the structure of Csm in complex with crRNA together with structures of cognate or non-cognate target RNA bound Csm complexes. We show that depending on complementarity with the 5' tag of crRNA, the 3' anti-tag region of target RNA binds at two distinct sites of the Csm complex. Importantly, the interaction between the non-complementary anti-tag region of cognate target RNA and Csm1 induces a conformational change at the Csm1 subunit that allosterically activates DNA cleavage and cOA generation. Together, our structural studies provide crucial insights into the mechanistic processes required for crRNA-meditated sequence-specific RNA cleavage, RNA target-dependent non-specific DNA cleavage, and cOA generation.

RevDate: 2018-12-03

Stella S, Mesa P, Thomsen J, et al (2018)

Conformational Activation Promotes CRISPR-Cas12a Catalysis and Resetting of the Endonuclease Activity.

Cell pii:S0092-8674(18)31401-6 [Epub ahead of print].

Cas12a, also known as Cpf1, is a type V-A CRISPR-Cas RNA-guided endonuclease that is used for genome editing based on its ability to generate specific dsDNA breaks. Here, we show cryo-EM structures of intermediates of the cleavage reaction, thus visualizing three protein regions that sense the crRNA-DNA hybrid assembly triggering the catalytic activation of Cas12a. Single-molecule FRET provides the thermodynamics and kinetics of the conformational activation leading to phosphodiester bond hydrolysis. These findings illustrate why Cas12a cuts its target DNA and unleashes unspecific cleavage activity, degrading ssDNA molecules after activation. In addition, we show that other crRNAs are able to displace the R-loop inside the protein after target DNA cleavage, terminating indiscriminate ssDNA degradation. We propose a model whereby the conformational activation of the enzyme results in indiscriminate ssDNA cleavage. The displacement of the R-loop by a new crRNA molecule will reset Cas12a specificity, targeting new DNAs.

RevDate: 2018-12-03

Wang M, HO Sintim (2018)

Discriminating cyclic from linear nucleotides - CRISPR/Cas-related cyclic hexaadenosine monophosphate as a case study.

Analytical biochemistry pii:S0003-2697(18)30951-5 [Epub ahead of print].

Nucleic acids exist in biological systems as linear and cyclic forms and in most cases the biology of the cyclic form is different from the linear form of exactly the same sequence. Case examples are cyclic nucleotides, second messengers in both prokaryotes and eukaryotes whereby the cyclic forms account for their interesting biological profiles and the actions of the cyclic nucleotides are terminated upon phosphodiesterase hydrolysis into linear forms. For mono and dinucleotides, it has been shown that vast conformational changes that accompany the hydrolysis of the cyclized form allow for discrimination between the cyclized and linear forms. As the ring size increases, it becomes difficult to use conformational or structural differences alone to discriminate between cyclic and linear nucleotides. Here we reveal that for the recently discovered CRISPR/Cas-related cyclic hexaadenosine monophosphate, it is possible to discriminate between the cyclized and linear forms. The structures of c-HexaAMP and linear form are different in acidic media and this structural difference facilitated a simple and practical detection platform for this interesting and new bacterial immunity-related molecule, and we also demonstrate that it is possible to distinguish between linear and cyclized polynucleotides using simple spectroscopic techniques, such as CD and fluorescence-based methods.

RevDate: 2018-12-05

Lima ARJ, Siqueira AS, de Vasconcelos JM, et al (2018)

Insights Into Limnothrix sp. Metabolism Based on Comparative Genomics.

Frontiers in microbiology, 9:2811.

Currently only four genome sequences for Limnothrix spp. are publicly available, and information on the genetic properties of cyanobacteria belonging to this genus is limited. In this study, we report the draft genome of Limnothrix sp. CACIAM 69d, isolated from the reservoir of a hydroelectric dam located in the Amazon ecosystem, from where cyanobacterial genomic data are still scarce. Comparative genomic analysis of Limnothrix revealed the presence of key enzymes in the cyanobacterial central carbon metabolism and how it is well equipped for environmental sulfur and nitrogen acquisition. Additionally, this work covered the analysis of Limnothrix CRISPR-Cas systems, pathways related to biosynthesis of secondary metabolites and assembly of extracellular polymeric substances and their exportation. A trans-AT PKS gene cluster was identified in two strains, possibly related to the novel toxin Limnothrixin biosynthesis. Overall, the draft genome of Limnothrix sp. CACIAM 69d adds new data to the small Limnothrix genome library and contributes to a growing representativeness of cyanobacterial genomes from the Amazon region. The comparative genomic analysis of Limnothrix made it possible to highlight unique genes for each strain and understand the overall features of their metabolism.

RevDate: 2018-12-05

Lee J, Mir A, Edraki A, et al (2018)

Potent Cas9 Inhibition in Bacterial and Human Cells by AcrIIC4 and AcrIIC5 Anti-CRISPR Proteins.

mBio, 9(6): pii:mBio.02321-18.

In their natural settings, CRISPR-Cas systems play crucial roles in bacterial and archaeal adaptive immunity to protect against phages and other mobile genetic elements, and they are also widely used as genome engineering technologies. Previously we discovered bacteriophage-encoded Cas9-specific anti-CRISPR (Acr) proteins that serve as countermeasures against host bacterial immunity by inactivating their CRISPR-Cas systems (A. Pawluk, N. Amrani, Y. Zhang, B. Garcia, et al., Cell 167:1829-1838.e9, 2016, https://doi.org/10.1016/j.cell.2016.11.017). We hypothesized that the evolutionary advantages conferred by anti-CRISPRs would drive the widespread occurrence of these proteins in nature (K. L. Maxwell, Mol Cell 68:8-14, 2017, https://doi.org/10.1016/j.molcel.2017.09.002; A. Pawluk, A. R. Davidson, and K. L. Maxwell, Nat Rev Microbiol 16:12-17, 2018, https://doi.org/10.1038/nrmicro.2017.120; E. J. Sontheimer and A. R. Davidson, Curr Opin Microbiol 37:120-127, 2017, https://doi.org/10.1016/j.mib.2017.06.003). We have identified new anti-CRISPRs using the same bioinformatic approach that successfully identified previous Acr proteins (A. Pawluk, N. Amrani, Y. Zhang, B. Garcia, et al., Cell 167:1829-1838.e9, 2016, https://doi.org/10.1016/j.cell.2016.11.017) against Neisseria meningitidis Cas9 (NmeCas9). In this work, we report two novel anti-CRISPR families in strains of Haemophilus parainfluenzae and Simonsiella muelleri, both of which harbor type II-C CRISPR-Cas systems (A. Mir, A. Edraki, J. Lee, and E. J. Sontheimer, ACS Chem Biol 13:357-365, 2018, https://doi.org/10.1021/acschembio.7b00855). We characterize the type II-C Cas9 orthologs from H. parainfluenzae and S. muelleri, show that the newly identified Acrs are able to inhibit these systems, and define important features of their inhibitory mechanisms. The S. muelleri Acr is the most potent NmeCas9 inhibitor identified to date. Although inhibition of NmeCas9 by anti-CRISPRs from H. parainfluenzae and S. muelleri reveals cross-species inhibitory activity, more distantly related type II-C Cas9s are not inhibited by these proteins. The specificities of anti-CRISPRs and divergent Cas9s appear to reflect coevolution of their strategies to combat or evade each other. Finally, we validate these new anti-CRISPR proteins as potent off-switches for Cas9 genome engineering applications.IMPORTANCE As one of their countermeasures against CRISPR-Cas immunity, bacteriophages have evolved natural inhibitors known as anti-CRISPR (Acr) proteins. Despite the existence of such examples for type II CRISPR-Cas systems, we currently know relatively little about the breadth of Cas9 inhibitors, and most of their direct Cas9 targets are uncharacterized. In this work we identify two new type II-C anti-CRISPRs and their cognate Cas9 orthologs, validate their functionality in vitro and in bacteria, define their inhibitory spectrum against a panel of Cas9 orthologs, demonstrate that they act before Cas9 DNA binding, and document their utility as off-switches for Cas9-based tools in mammalian applications. The discovery of diverse anti-CRISPRs, the mechanistic analysis of their cognate Cas9s, and the definition of Acr inhibitory mechanisms afford deeper insight into the interplay between Cas9 orthologs and their inhibitors and provide greater scope for exploiting Acrs for CRISPR-based genome engineering.

RevDate: 2018-12-05

Musharova O, Vyhovskyi D, Medvedeva S, et al (2018)

Avoidance of Trinucleotide Corresponding to Consensus Protospacer Adjacent Motif Controls the Efficiency of Prespacer Selection during Primed Adaptation.

mBio, 9(6): pii:mBio.02169-18.

CRISPR DNA arrays of unique spacers separated by identical repeats ensure prokaryotic immunity through specific targeting of foreign nucleic acids complementary to spacers. New spacers are acquired into a CRISPR array in a process of CRISPR adaptation. Selection of foreign DNA fragments to be integrated into CRISPR arrays relies on PAM (protospacer adjacent motif) recognition, as only those spacers will be functional against invaders. However, acquisition of different PAM-associated spacers proceeds with markedly different efficiency from the same DNA. Here, we used a combination of bioinformatics and experimental approaches to understand factors affecting the efficiency of acquisition of spacers by the Escherichia coli type I-E CRISPR-Cas system, for which two modes of CRISPR adaptation have been described: naive and primed. We found that during primed adaptation, efficiency of spacer acquisition is strongly negatively affected by the presence of an AAG trinucleotide-a consensus PAM-within the sequence being selected. No such trend is observed during naive adaptation. The results are consistent with a unidirectional spacer selection process during primed adaptation and provide a specific signature for identification of spacers acquired through primed adaptation in natural populations.IMPORTANCE Adaptive immunity of prokaryotes depends on acquisition of foreign DNA fragments into CRISPR arrays as spacers followed by destruction of foreign DNA by CRISPR interference machinery. Different fragments are acquired into CRISPR arrays with widely different efficiencies, but the factors responsible are not known. We analyzed the frequency of spacers acquired during primed adaptation in an E. coli CRISPR array and found that AAG motif was depleted from highly acquired spacers. AAG is also a consensus protospacer adjacent motif (PAM) that must be present upstream from the target of the CRISPR spacer for its efficient destruction by the interference machinery. These results are important because they provide new information on the mechanism of primed spacer acquisition. They add to other previous evidence in the field that pointed out to a "directionality" in the capture of new spacers. Our data strongly suggest that the recognition of an AAG PAM by the interference machinery components prior to spacer capture occludes downstream AAG sequences, thus preventing their recognition by the adaptation machinery.

RevDate: 2018-12-04

Lainšček D, Kadunc L, Manček-Keber M, et al (2018)

Delivery of an artificial transcription regulator dCas9-VPR by extracellular vesicles for therapeutic gene activation.

ACS synthetic biology [Epub ahead of print].

The CRISPR/Cas system has been developed as a potent tool for genome engineering and transcription regulation. However, the efficiency of its delivery into cells, particularly for therapeutic in vivo applications, remains a major bottleneck. Extracellular vesicles (EVs), released by eukaryotic cells, can mediate the transfer of different molecules, including nucleic acids and proteins. Here we show packaging and delivery of the CRISPR/Cas system via EVs to target cells, combining the advantages of both technological platforms. A GEDEX (genome editing with designed extracellular vesicles) system generated by the producer cells can transfer the designed transcriptional regulator dCas9-VPR complexed with appropriate targeting gRNAs enabling gene transcription activation. We show functional delivery in mammalian cells as well in the animals. By in vivo delivery of dCas9-VPR/sgRNA GEDEX therapeutic efficiency is demonstrated in a mouse model of liver damage counteracted by upregulation of the endogenous hepatocyte growth factor, demonstrating the potentials for therapeutic applications.

RevDate: 2018-12-04

Teng F, Cui T, Feng G, et al (2018)

Repurposing CRISPR-Cas12b for mammalian genome engineering.

Cell discovery, 4:63 pii:69.

The prokaryotic CRISPR-Cas adaptive immune systems provide valuable resources to develop genome editing tools, such as CRISPR-Cas9 and CRISPR-Cas12a/Cpf1. Recently, CRISPR-Cas12b/C2c1, a distinct type V-B system, has been characterized as a dual-RNA-guided DNA endonuclease system. Though being active in vitro, its cleavage activity at endogenous genome remains to be explored. Furthermore, the optimal cleavage temperature of the reported Cas12b orthologs is higher than 40 °C, which is unsuitable for mammalian applications. Here, we report the identification of a Cas12b system from the Alicyclobacillus acidiphilus (AaCas12b), which maintains optimal nuclease activity over a wide temperature range (31 °C-59 °C). AaCas12b can be repurposed to engineer mammalian genomes for versatile applications, including single and multiplex genome editing, gene activation, and generation of gene mutant mouse models. Moreover, whole-genome sequencing reveals high specificity and minimal off-target effects of AaCas12b-meditated genome editing. Our findings establish CRISPR-Cas12b as a versatile tool for mammalian genome engineering.

RevDate: 2018-12-04

Møller-Olsen C, Ho SFS, Shukla RD, et al (2018)

Engineered K1F bacteriophages kill intracellular Escherichia coli K1 in human epithelial cells.

Scientific reports, 8(1):17559 pii:10.1038/s41598-018-35859-6.

Bacterial infections can be treated with bacteriophages that show great specificity towards their bacterial host and can be genetically modified for different applications. However, whether and how bacteriophages can kill intracellular bacteria in human cells remains elusive. Here, using CRISPR/Cas selection, we have engineered a fluorescent bacteriophage specific for E. coli K1, a nosocomial pathogen responsible for urinary tract infections, neonatal meningitis and sepsis. By confocal and live microscopy, we show that engineered bacteriophages K1F-GFP and E. coli EV36-RFP bacteria displaying the K1 capsule, enter human cells via phagocytosis. Importantly, we show that bacteriophage K1F-GFP efficiently kills intracellular E. coli EV36-RFP in T24 human urinary bladder epithelial cells. Finally, we provide evidence that bacteria and bacteriophages are degraded by LC3-associated phagocytosis and xenophagy.

RevDate: 2018-12-04

Daly RA, Roux S, Borton MA, et al (2018)

Viruses control dominant bacteria colonizing the terrestrial deep biosphere after hydraulic fracturing.

Nature microbiology pii:10.1038/s41564-018-0312-6 [Epub ahead of print].

The deep terrestrial biosphere harbours a substantial fraction of Earth's biomass and remains understudied compared with other ecosystems. Deep biosphere life primarily consists of bacteria and archaea, yet knowledge of their co-occurring viruses is poor. Here, we temporally catalogued viral diversity from five deep terrestrial subsurface locations (hydraulically fractured wells), examined virus-host interaction dynamics and experimentally assessed metabolites from cell lysis to better understand viral roles in this ecosystem. We uncovered high viral diversity, rivalling that of peatland soil ecosystems, despite low host diversity. Many viral operational taxonomic units were predicted to infect Halanaerobium, the dominant microorganism in these ecosystems. Examination of clustered regularly interspaced short palindromic repeats-CRISPR-associated proteins (CRISPR-Cas) spacers elucidated lineage-specific virus-host dynamics suggesting active in situ viral predation of Halanaerobium. These dynamics indicate repeated viral encounters and changing viral host range across temporally and geographically distinct shale formations. Laboratory experiments showed that prophage-induced Halanaerobium lysis releases intracellular metabolites that can sustain key fermentative metabolisms, supporting the persistence of microorganisms in this ecosystem. Together, these findings suggest that diverse and active viral populations play critical roles in driving strain-level microbial community development and resource turnover within this deep terrestrial subsurface ecosystem.

RevDate: 2018-11-29

Miao K, Zhang X, Su SM, et al (2018)

Optimizing CRISPR/Cas9 technology for precise correction of the Fgfr3-Gly374Arg mutation in achondroplasia in mice.

The Journal of biological chemistry pii:RA118.006496 [Epub ahead of print].

CRISPR/Cas9 is a powerful technology widely used for genome editing, with the potential to be used for correcting a wide variety of deleterious disease-causing mutations. However, the technique tends to generate more indels (insertions and deletions) than precise modifications at the target sites, which might not resolve the mutation and could instead exacerbate the initial genetic disruption. We sought to develop an improved protocol for CRISPR/Cas9 that would correct mutations without unintended consequences. As a case study, we focused on achondroplasia, a common genetic form of dwarfism defined by missense mutation in the Fgfr3 gene that results in glycine-to-arginine substitution at position 374 in mice in fibroblast growth factor receptor 3 (Fgfr3-Gly374Arg), which corresponds to Gly380Arg in humans. First, we designed a GFP reporter system that can evaluate the cutting efficiency and specificity of sgRNAs. Using the sgRNA selected based on our GFP reporter system, we conducted targeted therapy of achondroplasia in mice. We found that we achieved higher frequency of precise correction of Fgfr3-Gly374Arg mutation using Cas9 protein rather than Cas9 mRNA. We further demonstrated that targeting oligos of 100nt and 200nt precisely corrected the mutation at equal efficiency. We showed that our strategy completely suppressed phenotypes of achondroplasia and whole genome sequencing detected no off-target effects. These data indicate that improved protocols can enable the precise CRISPR/Cas9 mediated correction of individual mutations with high fidelity.

RevDate: 2018-11-28

Zhang Y, Wang Y, Wang X, et al (2018)

Acetyl-coenzyme A acyltransferase 2 promote the differentiation of sheep precursor adipocytes into adipocytes.

Journal of cellular biochemistry [Epub ahead of print].

The acetyl CoA acyltransferase 2 (ACAA2) is a key enzyme of the fatty acid oxidation pathway, catalyzing the last step of the mitochondrial beta oxidation, thus playing an important role in the fatty acid metabolism. The purpose of this study was to investigate the effect of knocking out ACAA2 on the expression of genes lipoprteinlipase (LPL), peroxisome proliferator-activated receptor-γ (PPAR-γ), fatty acid synthase, fat mass and obesity-associated gene, adipocyte fatty acid-binding protein (AP2) in precursor adipocytes and their differentiation into adipocytes. The knockout vector was constructed using CRISPR-Cas RNA-guided nuclease technology with an efficiency of 23.80%, and the vector was transfected into precursor adipocyte cells, while an overexpression vector of the ACAA2 gene was also transfected in another group of preadipocytes. Quantitative polymerase chain reaction showed that the expression of the PPAR-γ, LPL, and AP2 was significantly lower in the knockout compared with the overexpression group, while there was no difference in cell growth. After induction of adipocyte precursor cells into adipocytes using dexamethasone, insulin, and IBMX, oil red staining showed a significantly different number of lipid droplets in the knockout group. These results provide a preliminary indication for a possible involvement of the ACAA2 gene in adipocyte differentiation in vitro.

RevDate: 2018-11-28

Nadakuduti SS, Buell CR, Voytas DF, et al (2018)

Genome Editing for Crop Improvement - Applications in Clonally Propagated Polyploids With a Focus on Potato (Solanum tuberosum L.).

Frontiers in plant science, 9:1607.

Genome-editing has revolutionized biology. When coupled with a recently streamlined regulatory process by the U.S. Department of Agriculture and the potential to generate transgene-free varieties, genome-editing provides a new avenue for crop improvement. For heterozygous, polyploid and vegetatively propagated crops such as cultivated potato, Solanum tuberosum Group Tuberosum L., genome-editing presents tremendous opportunities for trait improvement. In potato, traits such as improved resistance to cold-induced sweetening, processing efficiency, herbicide tolerance, modified starch quality and self-incompatibility have been targeted utilizing CRISPR/Cas9 and TALEN reagents in diploid and tetraploid clones. However, limited progress has been made in other such crops including sweetpotato, strawberry, grapes, citrus, banana etc., In this review we summarize the developments in genome-editing platforms, delivery mechanisms applicable to plants and then discuss the recent developments in regulation of genome-edited crops in the United States and The European Union. Next, we provide insight into the challenges of genome-editing in clonally propagated polyploid crops, their current status for trait improvement with future prospects focused on potato, a global food security crop.

RevDate: 2018-11-28

Bray C, Wright D, Haupt S, et al (2018)

Crispr/Cas Mediated Deletion of PTPN22 in Jurkat T Cells Enhances TCR Signaling and Production of IL-2.

Frontiers in immunology, 9:2595.

A single nucleotide polymorphism, C1858T, in the gene encoding the protein tyrosine phosphatase nonreceptor type 22 (PTPN22) results in one of the strongest genetic traits associated with autoimmune disease outside of the Major Histocompatibility Complex (MHC) genes. However, the consequences of this polymorphism, which introduces an arginine to tryptophan substitution at amino acid 620, for the function of PTPN22 protein is unclear and conflicting results have been obtained in human compared to mouse cells expressing this variant phosphatase. In mouse the variant appears to be a loss-of-function allele resembling a milder form of the null allele, while studies in human cells have reported it to be a gain-of-function mutation. To address whether the phosphatase has distinct functions in mouse vs. human T cells, we used CRISPR gene-editing to generate the first example of human PTPN22-KnockOut (KO) T cells. By comparing isogenic human T cells which express or lack PTPN22, we showed that PTPN22 KO T cells displayed enhanced expression of IL-2 and CD69 upon stimulation with cognate antigen. PTPN22 KO cells also showed increased Erk phosphorylation upon stimulation with weak antigen, but the difference was diminished in response to strong antigen, indicating that PTPN22 plays a more critical role in regulating weak-antigen responses. These data are in keeping with a role for PTPN22 in determining the threshold of stimulation required to activate T cells, a critical function of autoimmune pathogenesis. Our data indicate that PTPN22 has comparable functions in mouse and human T cells, and that the conflicting results in the literature regarding the impact of the point mutation are not due to differences in the activity of PTPN22 itself, but may be related to interactions with other proteins or splice variation.

RevDate: 2018-11-27

Turgeman-Grott I, Joseph S, Marton S, et al (2018)

Pervasive acquisition of CRISPR memory driven by inter-species mating of archaea can limit gene transfer and influence speciation.

Nature microbiology pii:10.1038/s41564-018-0302-8 [Epub ahead of print].

CRISPR-Cas systems provide prokaryotes with sequence-specific immunity against viruses and plasmids based on DNA acquired from these invaders, known as spacers. Surprisingly, many archaea possess spacers that match chromosomal genes of related species, including those encoding core housekeeping genes. By sequencing genomes of environmental archaea isolated from a single site, we demonstrate that inter-species spacers are common. We show experimentally, by mating Haloferax volcanii and Haloferax mediterranei, that spacers are indeed acquired chromosome-wide, although a preference for integrated mobile elements and nearby regions of the chromosome exists. Inter-species mating induces increased spacer acquisition and may result in interactions between the acquisition machinery of the two species. Surprisingly, many of the spacers acquired following inter-species mating target self-replicons along with those originating from the mating partner, indicating that the acquisition machinery cannot distinguish self from non-self under these conditions. Engineering the chromosome of one species to be targeted by the other's CRISPR-Cas reduces gene exchange between them substantially. Thus, spacers acquired during inter-species mating could limit future gene transfer, resulting in a role for CRISPR-Cas systems in microbial speciation.

RevDate: 2018-11-28

Teague WJ, Jones MLM, Hawkey L, et al (2018)

FGF10 and the Mystery of Duodenal Atresia in Humans.

Frontiers in genetics, 9:530.

Background: Duodenal atresia (DA) is a congenital obstruction of the duodenum, which affects 1 in 7000 pregnancies and requires major surgery in the 1st days of life. Three morphological DA types are described. In humans, the association between DA and Down syndrome suggests an underlying, albeit elusive, genetic etiology. In mice, interruption of fibroblast growth factor 10 (Fgf10) gene signaling results in DA in 30-50% of embryos, supporting a genetic etiology. This study aims to validate the spectrum of DA in two novel strains of Fgf10 knock-out mice, in preparation for future and translational research. Methods: Two novel CRISPR Fgf10 knock-out mouse strains were derived and embryos generated by heterozygous plug-mating. E15.5-E19.5 embryos were genotyped with respect to Fgf10 and micro-dissected to determine the presence and type of DA. Results: One twenty seven embryos (32 wild-type, 34 heterozygous, 61 null) were analyzed. No wild-type or heterozygous embryos had DA. However, 74% of Fgf10 null embryos had DA (49% type 1, 18% type 2, and 33% type 3). Conclusion: Our CRISPR-derived strains showed higher penetrance of DA due to single-gene deletion of Fgf10 in mice than previously reported. Further, the DA type distribution in these mice more closely reiterated that observed in humans. Future experiments will document RNA and protein expression of FGF10 and its key downstream signaling targets in normal and atretic duodenum. This includes exploitation of modern, high-fidelity developmental tools, e.g., Fgf10flox/+-tomatoflox/flox mice.

RevDate: 2018-11-30

Yan Y, GC Finnigan (2018)

Development of a multi-locus CRISPR gene drive system in budding yeast.

Scientific reports, 8(1):17277 pii:10.1038/s41598-018-34909-3.

The discovery of CRISPR/Cas gene editing has allowed for major advances in many biomedical disciplines and basic research. One arrangement of this biotechnology, a nuclease-based gene drive, can rapidly deliver a genetic element through a given population and studies in fungi and metazoans have demonstrated the success of such a system. This methodology has the potential to control biological populations and contribute to eradication of insect-borne diseases, agricultural pests, and invasive species. However, there remain challenges in the design, optimization, and implementation of gene drives including concerns regarding biosafety, containment, and control/inhibition. Given the numerous gene drive arrangements possible, there is a growing need for more advanced designs. In this study, we use budding yeast to develop an artificial multi-locus gene drive system. Our minimal setup requires only a single copy of S. pyogenes Cas9 and three guide RNAs to propagate three gene drives. We demonstrate how this system could be used for targeted allele replacement of native genes and to suppress NHEJ repair systems by modifying DNA Ligase IV. A multi-locus gene drive configuration provides an expanded suite of options for complex attributes including pathway redundancy, combatting evolved resistance, and safeguards for control, inhibition, or reversal of drive action.

RevDate: 2018-11-23

Monteiro R, Pires DP, Costa AR, et al (2018)

Phage Therapy: Going Temperate?.

Trends in microbiology pii:S0966-842X(18)30231-2 [Epub ahead of print].

Strictly lytic phages have been consensually preferred for phage therapy purposes. In contrast, temperate phages have been avoided due to an inherent capacity to mediate transfer of genes between bacteria by specialized transduction - an event that may increase bacterial virulence, for example, by promoting antibiotic resistance. Now, advances in sequencing technologies and synthetic biology are providing new opportunities to explore the use of temperate phages for therapy against bacterial infections. By doing so we can considerably expand our armamentarium against the escalating threat of antibiotic-resistant bacteria.

RevDate: 2018-11-27

Wong NK, Huang CL, Islam R, et al (2018)

Long non-coding RNAs in hematological malignancies: translating basic techniques into diagnostic and therapeutic strategies.

Journal of hematology & oncology, 11(1):131 pii:10.1186/s13045-018-0673-6.

Recent studies have revealed that non-coding regions comprise the vast majority of the human genome and long non-coding RNAs (lncRNAs) are a diverse class of non-coding RNAs that has been implicated in a variety of biological processes. Abnormal expression of lncRNAs has also been linked to different human diseases including cancers, yet the regulatory mechanisms and functional effects of lncRNAs are still ambiguous, and the molecular details also need to be confirmed. Unlike protein-coding gene, it is much more challenging to unravel the roles of lncRNAs owing to their unique and complex features such as functional diversity and low conservation among species, which greatly hamper their experimental characterization. In this review, we summarize and discuss both conventional and advanced approaches for the identification and functional characterization of lncRNAs related to hematological malignancies. In particular, the utility and advancement of clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system as gene-editing tools are envisioned to facilitate the molecular dissection of lncRNAs via different knock-in/out strategies. Besides experimental considerations specific to lncRNAs, the roles of lncRNAs in the pathogenesis and progression of leukemia are also highlighted in the review. We expect that these insights may ultimately lead to clinical applications including development of biomarkers and novel therapeutic approaches targeting lncRNAs.

RevDate: 2018-11-22

Gas-Pascual E, Ichikawa HT, Sheikh MO, et al (2018)

CRISPR/Cas9 and glycomics tools for Toxoplasma glycobiology.

The Journal of biological chemistry pii:RA118.006072 [Epub ahead of print].

Infection with the protozoan parasite Toxoplasma gondii is a major health risk owing to birth defects, its chronic nature, ability to reactivate to cause blindness and encephalitis, and high prevalence in human populations. Unlike most eukaryotes, Toxoplasma propagates in intracellular parasitophorous vacuoles, but as for nearly all other eukaryotes, Toxoplasma glycosylates many cellular proteins and lipids and assembles polysaccharides. Toxoplasma glycans resemble those of other eukaryotes but species-specific variations have prohibited deeper investigations into their roles in parasite biology and virulence. The Toxoplasma genome encodes a suite of likely glycogenes expected to assemble N-glycans, O-glycans, a C-glycan, GPI-anchors, and polysaccharides, along with their precursors and membrane transporters. To investigate the roles of specific glycans in Toxoplasma, here we coupled genetic and glycomics approaches to map the connections between 67 glycogenes, their enzyme products, the glycans to which they contribute, and cellular functions. We applied a double-CRISPR/Cas9 strategy, in which two guide RNAs promote replacement of a candidate gene with a resistance gene; adapted MS-based glycomics workflows to test for effects on glycan formation; and infected fibroblast monolayers to assess cellular effects. By editing 17 glycogenes, we discovered novel Glc0-2-Man6-GlcNAc2-type N-glycans, a novel HexNAc-GalNAc-mucin-type O-glycan, and Tn-antigen, identified the glycosyltransferases for assembling a novel nuclear O-Fuc-type and cell surface Glc-Fuc-type O-glycans, and showed that they are important for in vitro growth. The guide sequences, editing constructs, and mutant strains are freely available to researchers to investigate the roles of glycans in their favorite biological processes.

RevDate: 2018-11-21

LaRoche-Johnston F, Monat C, Coulombe S, et al (2018)

Bacterial group II introns generate genetic diversity by circularization and trans-splicing from a population of intron-invaded mRNAs.

PLoS genetics, 14(11):e1007792 pii:PGENETICS-D-18-01312.

Group II introns are ancient retroelements that significantly shaped the origin and evolution of contemporary eukaryotic genomes. These self-splicing ribozymes share a common ancestor with the telomerase enzyme, the spliceosome machinery as well as the highly abundant spliceosomal introns and non-LTR retroelements. More than half of the human genome thus consists of various elements that evolved from ancient group II introns, which altogether significantly contribute to key functions and genetic diversity in eukaryotes. Similarly, group II intron-related elements in bacteria such as abortive phage infection (Abi) retroelements, diversity generating retroelements (DGRs) and some CRISPR-Cas systems have evolved to confer important functions to their hosts. In sharp contrast, since bacterial group II introns are scarce, irregularly distributed and frequently spread by lateral transfer, they have mainly been considered as selfish retromobile elements with no beneficial function to their host. Here we unveil a new group II intron function that generates genetic diversity at the RNA level in bacterial cells. We demonstrate that Ll.LtrB, the model group II intron from Lactococcus lactis, recognizes specific sequence motifs within cellular mRNAs by base pairing, and invades them by reverse splicing. Subsequent splicing of ectopically inserted Ll.LtrB, through circularization, induces a novel trans-splicing pathway that generates exon 1-mRNA and mRNA-mRNA intergenic chimeras. Our data also show that recognition of upstream alternative circularization sites on intron-interrupted mRNAs release Ll.LtrB circles harboring mRNA fragments of various lengths at their splice junction. Intergenic trans-splicing and alternative circularization both produce novel group II intron splicing products with potential new functions. Overall, this work describes new splicing pathways in bacteria that generate, similarly to the spliceosome in eukaryotes, genetic diversity at the RNA level while providing additional functional and evolutionary links between group II introns, spliceosomal introns and the spliceosome.

RevDate: 2018-11-23

Tang Y, Y Fu (2018)

Class 2 CRISPR/Cas: an expanding biotechnology toolbox for and beyond genome editing.

Cell & bioscience, 8:59 pii:255.

Artificial nuclease-dependent DNA cleavage systems (zinc-finger nuclease, ZFN; transcription activator like effectors, TALENs) and exogenous nucleic acid defense systems (CRISPR/Cas) have been used in the new era for genome modification. The most widely used toolbox for genome editing, modulation and detection contains Types II, V and VI of CRISPR/Cas Class 2 systems, categorized and characterized by Cas9, Cas12a and Cas13 respectively. In this review, we (1) elaborate on the definition, classification, structures of CRISPR/Cas Class 2 systems; (2) advance our understanding of new molecular mechanisms and recent progress in their applications, especially beyond genome-editing applications; (3) provide the insights on the specificity, efficiency and versatility of each tool; (4) elaborate the enhancement on specificity and efficiency of the CRISPR/Cas toolbox. The expanding and concerted usage of the CRISPR/Cas tools is making them more powerful in genome editing and other biotechnology applications.

RevDate: 2018-11-19

Croteau FR, Rousseau GM, S Moineau (2018)

[The CRISPR-Cas system: beyond genome editing].

Medecine sciences : M/S, 34(10):813-819.

CRISPR-Cas is an adaptive immune system used by many microbes to defend against nucleic acids invasion such as viral genomes. The microbial system uses its CRISPR locus to store genetic information that will generate short CRISPR RNAs. The latter with endonucleases (Cas) prevent future viral infections. Parts of this system were exploited to develop a powerful genome editing tool that was adapted for a variety of organisms. The ability of the CRISPR-Cas9 technology to effectively and precisely cut a targeted genomic DNA region has the potential to may be one day cure genetic diseases. The malleability of this editing tool also offers a wide range of possibilities from modulations of gene expression to epigenetic modifications. The natural CRISPR loci found in bacteria can be used to differentiate microbial strains or to study the interactions between bacteria and its habitat. Addressing CRISPR-Cas fundamentals in microbes and its popular use in eukaryotes, this review presents an update on a system that has revolutionized biological sciences.

RevDate: 2018-11-17

Liu Q, Wang C, Jiao X, et al (2018)

Hi-TOM: a platform for high-throughput tracking of mutations induced by CRISPR/Cas systems.

Science China. Life sciences pii:10.1007/s11427-018-9402-9 [Epub ahead of print].

The CRISPR/Cas system has been extensively applied to make precise genetic modifications in various organisms. Despite its importance and widespread use, large-scale mutation screening remains time-consuming, labour-intensive and costly. Here, we developed Hi-TOM (available at https://doi.org/www.hi-tom.net/hi-tom/), an online tool to track the mutations with precise percentage for multiple samples and multiple target sites. We also described a corresponding next-generation sequencing (NGS) library construction strategy by fixing the bridge sequences and barcoding primers. Analysis of the samples from rice, hexaploid wheat and human cells reveals that the Hi-TOM tool has high reliability and sensitivity in tracking various mutations, especially complex chimeric mutations frequently induced by genome editing. Hi-TOM does not require special design of barcode primers, cumbersome parameter configuration or additional data analysis. Thus, the streamlined NGS library construction and comprehensive result output make Hi-TOM particularly suitable for high-throughput identification of all types of mutations induced by CRISPR/Cas systems.

RevDate: 2018-11-16

Mo CY, LA Marraffini (2018)

If You'd Like to Stop a Type III CRISPR Ribonuclease, Then You Should Put a Ring (Nuclease) on It.

Molecular cell, 72(4):608-609.

Athukoralage et al. (2018) identify a new class of nuclease that degrades cyclic oligoadenylate (cOA), a second messenger that activates non-specific RNA degradation by the type III CRISPR-Cas accessory RNase Csm6/Csx1. This discovery provides a mechanism for regulating the degradation of foreign transcripts during the type III CRISPR immune response.

RevDate: 2018-11-25

Riad A, Zeng C, Weng CC, et al (2018)

Sigma-2 Receptor/TMEM97 and PGRMC-1 Increase the Rate of Internalization of LDL by LDL Receptor through the Formation of a Ternary Complex.

Scientific reports, 8(1):16845 pii:10.1038/s41598-018-35430-3.

CRISPR/Cas gene studies were conducted in HeLa cells where either PGRMC1, TMEM97 or both proteins were removed via gene editing. A series of radioligand binding studies, confocal microscopy studies, and internalization of radiolabeled or fluorescently tagged LDL particles were then conducted in these cells. The results indicate that PGRMC1 knockout (KO) did not reduce the density of binding sites for the sigma-2 receptor (σ2R) radioligands, [125I]RHM-4 or [3H]DTG, but a reduction in the receptor affinity of both radioligands was observed. TMEM97 KO resulted in a complete loss of binding of [125I]RHM-4 and a significant reduction in binding of [3H]DTG. TMEM97 KO and PGRMC1 KO resulted in an equal reduction in the rate of uptake of fluorescently-tagged or 3H-labeled LDL, and knocking out both proteins did not result in a further rate of reduction of LDL uptake. Confocal microscopy and Proximity Ligation Assay studies indicated a clear co-localization of LDLR, PGRMC1 and TMEM97. These data indicate that the formation of a ternary complex of LDLR-PGRMC1-TMEM97 is necessary for the rapid internalization of LDL by LDLR.

RevDate: 2018-11-15

Strich JR, DS Chertow (2018)

CRISPR-Cas Biology and Infectious Diseases Applications.

Journal of clinical microbiology pii:JCM.01307-18 [Epub ahead of print].

Infectious diseases remain a global threat contributing to excess morbidity and mortality annually with persistent potential for destabilizing pandemics. Improved understanding of the pathogenesis of bacteria, viruses, fungi, and parasites, along with rapid diagnosis and treatment of human infections are essential to improving infectious diseases outcomes worldwide. Genomic loci in bacteria and archea, termed Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR associated (Cas) proteins, function as an adaptive immune system for prokaryotes protecting against foreign invaders. CRISPR-Cas9 is now routinely applied for efficient gene editing contributing to advances in biomedical science. In the past decade improved understanding of other diverse CRISPR-Cas systems has expanded CRISPR applications, including in the field of infectious diseases. In this review, we summarize the biology of CRISPR-Cas systems and discuss existing and emerging applications to evaluate mechanisms of host-pathogen interactions, to develop accurate and portable diagnostics, and to advance prevention and treatment of infectious diseases.

RevDate: 2018-11-14

Hahn F, V Nekrasov (2018)

CRISPR/Cas precision: do we need to worry about off-targeting in plants?.

Plant cell reports pii:10.1007/s00299-018-2355-9 [Epub ahead of print].

The CRISPR/Cas technology has recently become the tool of choice for targeted genome modification in plants and beyond. Although CRSIPR/Cas offers a rapid and facile way of introducing changes at genomic loci of interest, its application is associated with off-targeting, i.e. introduction of unintended mutations at off-target sites within the genome, which has been reported frequently in the mammalian field. Here we summarise the current knowledge on the precision of CRISPR/Cas in plant systems and provide a summary of state-of the-art strategies for avoiding off-target mutations, as well as unintended on-target changes, in plants. These include using natural (e.g. Cas12a) or engineered (e.g. SpCas9-HF) CRISPR/Cas nucleases characterised by higher precision, as compared to the commonly used wild type SpCas9. In addition, we discuss the usage of CRISPR/Cas nucleases in the form of ribonucleoproteins (RNPs) as an option for reducing off-targeting in plants. Finally, we conclude that the most important factor for reducing CRISPR/Cas off-targeting remains careful selection of target sequences, for which we provide an overview of available online software tools and experimental guidance.

RevDate: 2018-11-17

Høyland-Kroghsbo NM, Muñoz KA, BL Bassler (2018)

Temperature, by Controlling Growth Rate, Regulates CRISPR-Cas Activity in Pseudomonas aeruginosa.

mBio, 9(6): pii:mBio.02184-18.

Clustered regularly interspaced short palindromic repeat (CRISPR)-associated (CRISPR-Cas) systems are adaptive defense systems that protect bacteria and archaea from invading genetic elements. In Pseudomonas aeruginosa, quorum sensing (QS) induces the CRISPR-Cas defense system at high cell density when the risk of bacteriophage infection is high. Here, we show that another cue, temperature, modulates P. aeruginosa CRISPR-Cas. Increased CRISPR adaptation occurs at environmental (i.e., low) temperatures compared to that at body (i.e., high) temperature. This increase is a consequence of the accumulation of CRISPR-Cas complexes, coupled with reduced P. aeruginosa growth rate at the lower temperature, the latter of which provides additional time prior to cell division for CRISPR-Cas to patrol the cell and successfully eliminate and/or acquire immunity to foreign DNA. Analyses of a QS mutant and synthetic QS compounds show that the QS and temperature cues act synergistically. The diversity and level of phage encountered by P. aeruginosa in the environment exceed that in the human body, presumably warranting increased reliance on CRISPR-Cas at environmental temperatures.IMPORTANCEP. aeruginosa is a soil dwelling bacterium and a plant pathogen, and it also causes life-threatening infections in humans. Thus, P. aeruginosa thrives in diverse environments and over a broad range of temperatures. Some P. aeruginosa strains rely on the CRISPR-Cas adaptive immune system as a phage defense mechanism. Our discovery that low temperatures increase CRISPR adaptation suggests that the rarely occurring but crucial naive adaptation events may take place predominantly under conditions of slow growth, e.g., during the bacterium's soil dwelling existence and during slow growth in biofilms.

RevDate: 2018-11-12

Gordeeva J, Morozova N, Sierro N, et al (2018)

BREX system of Escherichia coli distinguishes self from non-self by methylation of a specific DNA site.

Nucleic acids research pii:5173666 [Epub ahead of print].

Prokaryotes evolved numerous systems that defend against predation by bacteriophages. In addition to well-known restriction-modification and CRISPR-Cas immunity systems, many poorly characterized systems exist. One class of such systems, named BREX, consists of a putative phosphatase, a methyltransferase and four other proteins. A Bacillus cereus BREX system provides resistance to several unrelated phages and leads to modification of specific motif in host DNA. Here, we study the action of BREX system from a natural Escherichia coli isolate. We show that while it makes cells resistant to phage λ infection, induction of λ prophage from cells carrying BREX leads to production of viruses that overcome the defense. The induced phage DNA contains a methylated adenine residue in a specific motif. The same modification is found in the genome of BREX-carrying cells. The results establish, for the first time, that immunity to BREX system defense is provided by an epigenetic modification.

RevDate: 2018-11-12

Aung MS, San T, San N, et al (2018)

Molecular characterization of Staphylococcus argenteus in Myanmar: identification of novel genotypes/clusters in staphylocoagulase, protein A, alpha-haemolysin and other virulence factors.

Journal of medical microbiology [Epub ahead of print].

PURPOSE: Staphylococcus argenteus is a novel emerging species of coagulase-positive staphylococcus that is genetically closely related to Staphylococcus aureus. To elucidate the molecular differences in the virulence factors (staphylocoagulase, protein A, alpha-haemolysin, enterotoxin-like toxin and staphylokinase) between these staphylococcal species, S. argenteus that had recently been isolated in Myanmar (five nasal isolates and four clinical isolates) were analysed.

METHODOLOGY: The nucleotide sequences of the virulence factors were determined by PCR and direct sequencing, followed by phylogenetic analysis by mega6 and multiple alignment by clustalw using the published sequence data for S. aureus and S. argenteus.

RESULTS: Six S. argenteus isolates belonged to MLST sequence type (ST) 2250, while others belonged to ST4625, ST2198 and ST2854. The novel staphylocoagulase (coa) genotype XIV and the novel coa-XI subtype (XId) were identified in an ST2198 isolate and all other isolates, respectively. Among the S. argenteus isolates, the protein A and alpha-haemolysin genes showed high sequence identity (96-98 % and >99 %, respectively), while lower identity was observed between S. argenteus and S. aureus (88-91 % and 86 %, respectively), with both species showing phylogenetically distinct clusters. Similar findings were found for the staphylococcal enterotoxin (SE)-like toxin genes selw, selx and sely. In contrast, the staphylokinase genes were almost identical between these two species. All of the coa-XId isolates had a CRISPR/Cas locus at the site of orfX without having SCCmec, whereas an ST2198 isolate lacked this locus.

CONCLUSION: The primary virulence factors (staphylocoagulase, protein A andalpha-haemolysin) as well as the SE-like toxins of S. argenteus were genetically discriminated from those of S. aureus, revealing the presence of the novel coa-type/subtype (coa-IXd, XIV) in S. argenteus.

RevDate: 2018-11-10

Li CJ, Jiang C, Liu Y, et al (2018)

Pleiotropic Action of Novel Bruton's Tyrosine Kinase Inhibitor BGB-3111 in Mantle Cell Lymphoma.

Molecular cancer therapeutics pii:1535-7163.MCT-18-0478 [Epub ahead of print].

Bruton's tyrosine kinase (BTK) is a key mediator of BCR-dependent cell growth signaling and a clinically effective therapeutic target in mantle cell lymphoma (MCL). The molecular impact of BTK inhibition remains unclear particularly in hematopoietic malignancies. We analyzed the molecular mechanisms of BTK inhibition with the novel inhibitor BGB-3111 (zanubrutinib) in MCL models. The efficacy of BGB-3111 was investigated using growth proliferation/cell viability and apoptosis assays in MCL cell lines and patient-derived xenograft (PDX) MCL cells. The activity and mechanisms of BGB-3111 were further confirmed using a cell line xenograft model, an MCL PDX mouse model, and a human phosphokinase profiler array and reverse phase protein array. Lastly, the mechanisms related to resistance to BTK inhibition were analyzed by creating cell lines with low levels of BTK using CRISPR/Cas 9 genome editing. We found that inhibition of BTK leads to suppression of tumor growth, which was mediated via potent suppression of Akt/mTOR, apoptosis, and metabolic stress. Moreover, targeted disruption of the BTK gene in MCL cells resulted in resistance to BTK inhibition and the emergence of novel survival mechanisms. Our studies suggest a general efficacy of BTK inhibition in MCL and potential drug resistance mechanism via alternative signaling pathways.

RevDate: 2018-11-14

Chatterjee P, Jakimo N, JM Jacobson (2018)

Minimal PAM specificity of a highly similar SpCas9 ortholog.

Science advances, 4(10):eaau0766 pii:aau0766.

RNA-guided DNA endonucleases of the CRISPR-Cas system are widely used for genome engineering and thus have numerous applications in a wide variety of fields. CRISPR endonucleases, however, require a specific protospacer adjacent motif (PAM) flanking the target site, thus constraining their targetable sequence space. In this study, we demonstrate the natural PAM plasticity of a highly similar, yet previously uncharacterized, Cas9 from Streptococcus canis (ScCas9) through rational manipulation of distinguishing motif insertions. To this end, we report affinity to minimal 5'-NNG-3' PAM sequences and demonstrate the accurate editing capabilities of the ortholog in both bacterial and human cells. Last, we build an automated bioinformatics pipeline, the Search for PAMs by ALignment Of Targets (SPAMALOT), which further explores the microbial PAM diversity of otherwise overlooked Streptococcus Cas9 orthologs. Our results establish that ScCas9 can be used both as an alternative genome editing tool and as a functional platform to discover novel Streptococcus PAM specificities.

RevDate: 2018-11-06

Özcan A, Pausch P, Linden A, et al (2018)

Type IV CRISPR RNA processing and effector complex formation in Aromatoleum aromaticum.

Nature microbiology pii:10.1038/s41564-018-0274-8 [Epub ahead of print].

Type IV CRISPR-Cas modules belong to class 1 prokaryotic adaptive immune systems, which are defined by the presence of multisubunit effector complexes. They usually lack the known Cas proteins involved in adaptation and target cleavage, and their function has not been experimentally addressed. To investigate RNA and protein components of this CRISPR-Cas type, we located a complete type IV cas gene locus and an adjacent CRISPR array on a megaplasmid of Aromatoleum aromaticum EbN1, which contains an additional type I-C system on its chromosome. RNA sequencing analyses verified CRISPR RNA (crRNA) production and maturation for both systems. Type IV crRNAs were shown to harbour unusually short 7 nucleotide 5'-repeat tags and stable 3' hairpin structures. A unique Cas6 variant (Csf5) was identified that generates crRNAs that are specifically incorporated into type IV CRISPR-ribonucleoprotein (crRNP) complexes. Structures of RNA-bound Csf5 were obtained. Recombinant production and purification of the type IV Cas proteins, together with electron microscopy, revealed that Csf2 acts as a helical backbone for type IV crRNPs that include Csf5, Csf3 and a large subunit (Csf1). Mass spectrometry analyses identified protein-protein and protein-RNA contact sites. These results highlight evolutionary connections between type IV and type I CRISPR-Cas systems and demonstrate that type IV CRISPR-Cas systems employ crRNA-guided effector complexes.

RevDate: 2018-11-05

Li P, Fu X, Zhang L, et al (2018)

CRISPR/Cas-based screening of a gene activation library in Saccharomyces cerevisiae identifies a crucial role of OLE1 in thermotolerance.

Microbial biotechnology [Epub ahead of print].

CRISPR/Cas-based (clustered regularly interspaced short palindromic repeats/CRISPR-associated) screening has been proved to be an efficient method to study functional genomics from yeast to human. In this study, we report the development of a focused CRISPR/Cas-based gene activation library in Saccharomyces cerevisiae and its application in gene identification based on functional screening towards improved thermotolerance. The gene activation library was subjected to screening at 42°C, and the same library cultured at 30°C was set as a control group. After five successive subcultures, five clones were randomly picked from the libraries cultured at 30 and 42°C, respectively. The five clones selected at 30°C contain the specificity sequences of five different single guide RNAs, whereas all the five clones selected at 42°C contain the specificity sequence of one sgRNA that targets the promoter region of OLE1. A crucial role of OLE1 in thermotolerance was identified: the overexpression of OLE1 increased fatty acid unsaturation, and thereby helped counter lipid peroxidation caused by heat stress, rendering the yeast thermotolerant. This study described the application of CRISPR/Cas-based gene activation screening with an example of thermotolerant yeast screening, demonstrating that this method can be used to identify functional genes in yeast.

RevDate: 2018-11-05

Borton MA, Daly RA, O'Banion B, et al (2018)

Comparative genomics and physiology of the genus Methanohalophilus, a prevalent methanogen in hydraulically fractured shale.

Environmental microbiology [Epub ahead of print].

About 60% of natural gas production in the United States comes from hydraulic fracturing of unconventional reservoirs, such as shales or organic-rich micrites. This process inoculates and enriches for halotolerant microorganisms in these reservoirs over time, resulting in a saline ecosystem that includes methane producing archaea. Here, we survey the biogeography of methanogens across unconventional reservoirs, and report that members of genus Methanohalophilus are recovered from every hydraulically fractured unconventional reservoir sampled by metagenomics. We provide the first genomic sequencing of three isolate genomes, as well as two metagenome assembled genomes. Utilizing six other previously sequenced genomes, we perform comparative analysis of the 11 genomes representing this genus. This genomic investigation revealed distinctions between surface and subsurface derived genomes that are consistent with constraints encountered in each environment. Genotypic differences were also uncovered between isolate genomes recovered from the same well, suggesting niche partitioning among closely related strains. These genomic substrate utilization predictions were then confirmed by physiological investigation. Fine-scale microdiversity was observed in CRISPR-Cas systems of Methanohalophilus, with genomes from geographically distinct unconventional reservoirs sharing spacers targeting the same viral population. These findings have implications for augmentation strategies resulting in enhanced biogenic methane production in hydraulically fractured unconventional reservoirs. This article is protected by copyright. All rights reserved.

RevDate: 2018-11-05

Ali S, Park SK, WC Kim (2018)

The pragmatic introduction and expression of microbial transgenes in plants.

Journal of microbiology and biotechnology pii:10.4014/jmb.1808.08029 [Epub ahead of print].

Several genetic strategies have been proposed for the successful transformation and expression of microbial transgenes in model and crop plants. Here, we bring into focus the prominent applications of microbial transgenes in plants for the development of disease resistance; mitigation of stress conditions; augmentation of food quality; and use of plants as "bioreactors" for the production of recombinant proteins, industrially important enzymes, vaccines, antimicrobial compounds, and other valuable secondary metabolites. We discuss the applicable and cost-effective approaches of transgenesis in different plants, as well as the limitations thereof. We subsequently present the contemporary developments in targeted genome editing systems that have facilitated the process of genetic modification and manifested stable and consumer-friendly genetically modified plants and their products. Finally, this article presents the different approaches and demonstrates the introduction and expression of microbial transgenes for the improvement of plant resistance to pathogens and abiotic stress conditions and the production of valuable compounds, together with the promising research progress in targeted genome editing technology. We include a special discussion on the highly efficient CRISPR-Cas system helpful in microbial transgene editing in plants.

RevDate: 2018-11-14

Zhang F, Zhao S, Ren C, et al (2018)

CRISPRminer is a knowledge base for exploring CRISPR-Cas systems in microbe and phage interactions.

Communications biology, 1:180 pii:184.

CRISPR-Cas systems not only play key roles in prokaryotic acquired immunity, but can also be adapted as powerful genome editing tools. Understanding the native role of CRISPR-Cas systems in providing adaptive immunity can lead to new CRISPR-based technologies. Here, we develop CRISPRminer, a knowledge base and web server to comprehensively collect and investigate the knowledge of CRISPR-Cas systems and generate instructive annotations, including CRISPR arrays and Cas protein annotation, CRISPR-Cas system classification, self-targeting events detection, microbe-phage interaction inference, and anti-CRISPR annotation. CRISPRminer is user-friendly and freely available at http://www.microbiome-bigdata.com/CRISPRminer.

RevDate: 2018-11-17

Hussain W, Mahmood T, Hussain J, et al (2018)

CRISPR/Cas system: A game changing genome editing technology, to treat human genetic diseases.

Gene, 685:70-75 pii:S0378-1119(18)31116-8 [Epub ahead of print].

Genes, are the functional units of heredity that used as an instructors to make proteins either to become the functional or structural part of the cell. Hence, the proteins get more attention because most of the life functions depends on it. Any mutation or alteration in genome sequences results in complete loss of function or formation of abnormal protein which leads to hereditary disorder. Gene therapy on the other hand, used as a remedy, a process that make correction in the gene which is responsible for genomic disorders. The treatment of disease state depends on the understanding of their genetic basis. While, numerous molecular genome editing tools have been developed and are being utilized to translate the abstract of gene therapy into reality, but the problem is still a mystery. The genome editing molecular scissors can be applied to dictate the selected genetic products that can have the therapeutic power. Thus, editing the specific sequences depends on the type of strategies being used by a molecule such is HDR or NHEJ. CRISPR/Cas9 editing technology can use in disease model to study the genitival disorders. One side the CRISPR technology seemed to be extremely accurate but on the other side it has some harmful effects i.e. Cas9 proteins sometimes cuts the similar sequences other than the specific targeted and Off-targeting Sequences etc. Urgent attention and improvement are needed for various implication of CRISPR/Cas9 technology, including the delivery, precision and control over the mention system. This review presents the current scenario of genome editing in vivo and its implications for the future of human genetic disease treatment as well as genome throughput potency.

RevDate: 2018-11-15

Chen H, Li Y, Du C, et al (2018)

Aptazyme-mediated direct modulation of post-transcriptional sgRNA level for conditional genome editing and gene expression.

Journal of biotechnology, 288:23-29 pii:S0168-1656(18)30675-8 [Epub ahead of print].

RNA-guided endonuclease Cas9 derived from microbial CRISPR-Cas adaptive immune systems is a powerful tool for genome editing, which has been widely used in eukaryotic systems, prokaryotic systems, and plants. However, the off-target effects caused by Cas9/sgRNA remain a major concern. Currently, the efforts to reduce the off-target effects mainly focus on improving the targeting specificity of sgRNA/Cas9, regulating the activity of the Cas9 protein or the sgRNA, and controlling the time window of their expression. In this study, a novel system was established to regulate the post-transcriptional sgRNA level by small molecule-controlled aptazyme. This system was shown to reduce the off-target effects caused by Cas9/sgRNA, while enabling precise temporal control over gene editing and regulatory activity. This new system could provide a potentially safer and more powerful tool for genome editing and therapeutic application.

RevDate: 2018-11-03

Lynch JM, Li B, Katoli P, et al (2018)

Binding of a glaucoma-associated myocilin variant to the αB-crystallin chaperone impedes protein clearance in trabecular meshwork cells.

The Journal of biological chemistry pii:RA118.004325 [Epub ahead of print].

Myocilin (MYOC) was discovered more than 20 years ago and is the gene whose mutations are most commonly observed in individuals with glaucoma. Despite extensive research efforts, the function of wild-type (wt) MYOC has remained elusive and how mutant MYOC is linked to glaucoma is unclear. Mutant MYOC is believed to be misfolded within the endoplasmic reticulum (ER), and under normal physiological conditions misfolded MYOC should be retro-translocated to the cytoplasm for degradation. To better understand mutant MYOC pathology, we CRISPR-engineered a rat to have a MYOC Y435H substitution which is the equivalent of the pathologic human MYOC Y437H mutation. Using this engineered animal model, we discovered that the chaparone αB-crystallin (CRYAB) is a MYOC-binding partner and that co-expression of these two proteins increases protein aggregates. Our results suggest that the misfolded mutant MYOC aggregates with cytoplasmic CRYAB and thereby compromises protein clearance mechanisms in trabecular meshwork cells and this process represents the primary mode of mutant MYOC pathology. We propose a model by which mutant MYOC causes glaucoma, and we propose that therapeutic treatment of patients having a MYOC mutation may focus on disrupting the MYOC-CRYAB complexes.

RevDate: 2018-11-03

Dion MB, Labrie SJ, Shah SA, et al (2018)

CRISPRStudio: A User-Friendly Software for Rapid CRISPR Array Visualization.

Viruses, 10(11): pii:v10110602.

The CRISPR-Cas system biologically serves as an adaptive defense mechanism against phages. However, there is growing interest in exploiting the hypervariable nature of the CRISPR locus, often of viral origin, for microbial typing and tracking. Moreover, the spacer content of any given strain provides a phage resistance profile. Large-scale CRISPR typing studies require an efficient method for showcasing CRISPR array similarities across multiple isolates. Historically, CRISPR arrays found in microbes have been represented by colored shapes based on nucleotide sequence identity and, while this approach is now routinely used, only scarce computational resources are available to automate the process, making it very time-consuming for large datasets. To alleviate this tedious task, we introduce CRISPRStudio, a command-line tool developed to accelerate CRISPR analysis and standardize the preparation of CRISPR array figures. It first compares nucleotide spacer sequences present in a dataset and then clusters them based on sequence similarity to assign a meaningful representative color. CRISPRStudio offers versatility to suit different biological contexts by including options such as automatic sorting of CRISPR loci and highlighting of shared spacers, while remaining fast and user-friendly.

RevDate: 2018-11-20

Terns MP (2018)

CRISPR-Based Technologies: Impact of RNA-Targeting Systems.

Molecular cell, 72(3):404-412.

DNA-targeting CRISPR-Cas systems, such as those employing the RNA-guided Cas9 or Cas12 endonucleases, have revolutionized our ability to predictably edit genomes and control gene expression. Here, I summarize information on RNA-targeting CRISPR-Cas systems and describe recent advances in converting them into powerful and programmable RNA-binding and cleavage tools with a wide range of novel and important biotechnological and biomedical applications.

RevDate: 2018-11-02

Kumlehn J, Pietralla J, Hensel G, et al (2018)

The CRISPR/Cas revolution continues: From efficient gene editing for crop breeding to plant synthetic biology.

Journal of integrative plant biology [Epub ahead of print].

Since the discovery that nucleases of the bacterial CRISPR/Cas system can be used as easily programmable tools for genome engineering, their application massively transformed different areas of plant biology. In this review, we assess the current state of their use for crop breeding to incorporate attractive new agronomical traits into specific cultivars of various crop plants. This can be achieved by the use of Cas9/12 nucleases for double strand break induction, resulting in mutations by non-homologous recombination. Strategies for performing such experiments - from the design of guide RNA to the use of different transformation technologies - are evaluated. Furthermore, we sum up recent developments regarding the use of nuclease-deficient Cas9/12 proteins, as DNA-binding moieties for targeting different kinds of enzyme activities to specific sites within the genome. Progress in base deamination, transcriptional induction and transcriptional repression, as well as in imaging in plants, is also discussed. As different Cas9/12 enzymes are at hand, the simultaneous application of various enzyme activities, to multiple genomic sites, is now in reach to redirect plant metabolism in a multifunctional manner and pave the way for a new level of plant synthetic biology.

RevDate: 2018-11-14

Guzina J, Chen WH, Stankovic T, et al (2018)

In silico Analysis Suggests Common Appearance of scaRNAs in Type II Systems and Their Association With Bacterial Virulence.

Frontiers in genetics, 9:474.

In addition to its well-established defense function, CRISPR/Cas can also exhibit crucial non-canonical activity through endogenous gene expression regulation, which was found to mainly affect bacterial virulence. These non-canonical functions depend on scaRNA, which is a small RNA encoded outside of CRISPR array, that is typically flanked by a transcription start site (TSS) and a terminator, and is in part complementary to another small CRISPR/Cas-associated RNA (tracrRNAs). Identification of scaRNAs is however largely complicated by the scarcity of RNA-Seq data across different bacteria, so that they were identified only in a relatively rare CRISPR/Cas subtype (IIB), and the possibility of finding them in other Type II systems is currently unclear. This study presents the first effort toward systematic detection of small CRISPR/Cas-associated regulatory RNAs, where obtained predictions can guide future experiments. The core of our approach is ab initio detection of small RNAs from bacterial genome, which is based on jointly predicting transcription signals - TSS and terminators - and homology to CRISPR array repeat. Particularly, we employ our improved approach for detecting bacterial TSS, since accurate TSS detection is the main limiting factor for accurate small RNA prediction. We also explore how our predictions match to available RNA-Seq data and analyze their conservation across related bacterial species. In Type IIB systems, our predictions are consistent with experimental data, and we systematically identify scaRNAs throughout this subtype. Furthermore, we identify scaRNA:tracrRNA pairs in a number of IIA/IIC systems, where the appearance of scaRNAs co-occurs with the strains being pathogenic. RNA-Seq and conservation analysis show that our method is well suited for predicting CRISPR/Cas-associated small RNAs. We also find possible existence of a modified mechanism of CRISPR-associated small RNA action, which, interestingly, closely resembles the setup employed in biotechnological applications. Overall, our findings indicate that scaRNA:tracrRNA pairs are present in all subtypes of Type II systems, and point to an underlying connection with bacterial virulence. In addition to formulating these hypotheses, careful manual curation that we performed, makes an important first step toward fully automated predictor of CRISPR/Cas-associated small RNAs, which will allow their large scale analysis across diverse bacterial genomes.

RevDate: 2018-11-14

Shankar S, Sreekumar A, Prasad D, et al (2018)

Genome editing of oncogenes with ZFNs and TALENs: caveats in nuclease design.

Cancer cell international, 18:169 pii:666.

Background: Gene knockout technologies involving programmable nucleases have been used to create knockouts in several applications. Gene editing using Zinc-finger nucleases (ZFNs), Transcription activator like effectors (TALEs) and CRISPR/Cas systems has been used to create changes in the genome in order to make it non-functional. In the present study, we have looked into the possibility of using six fingered CompoZr ZFN pair to target the E6 gene of HPV 16 genome.

Methods: HPV 16+ve cell lines; SiHa and CaSki were used for experiments. CompoZr ZFNs targeting E6 gene were designed and constructed by Sigma-Aldrich. TALENs targeting E6 and E7 genes were made using TALEN assembly kit. Gene editing was monitored by T7E1 mismatch nuclease and Nuclease resistance assays. Levels of E6 and E7 were further analyzed by RT-PCR, western blot as well as immunoflourescence analyses. To check if there is any interference due to methylation, cell lines were treated with sodium butyrate, and Nocodazole.

Results: Although ZFN editing activity in yeast based MEL-I assay was high, it yielded very low activity in tumor cell lines; only 6% editing in CaSki and negligible activity in SiHa cell lines. Though editing efficiency was better in CaSki, no significant reduction in E6 protein levels was observed in immunocytochemical analysis. Further, in silico analysis of DNA binding prediction revealed that some of the ZFN modules bound to sequence that did not match the target sequence. Hence, alternate ZFN pairs for E6 and E7 were not synthesized since no further active sites could be identified by in silico analyses. Then we designed TALENs to target E6 and E7 gene. TALENs designed to target E7 gene led to reduction of E7 levels in CaSki and SiHa cervical cancer cell lines. However, TALEN designed to target E6 gene did not yield any editing activity.

Conclusions: Our study highlights that designed nucleases intended to obtain bulk effect should have a reasonable editing activity which reflects phenotypically as well. Nucleases with low editing efficiency, intended for generation of knockout cell lines nucleases could be obtained by single cell cloning. This could serve as a criterion for designing ZFNs and TALENs.

RevDate: 2018-11-01

Wang HC, Wang P, Chen YW, et al (2018)

Bevacizumab or fibronectin gene editing inhibits the osteoclastogenic effects of fibroblasts derived from human radicular cysts.

Acta pharmacologica Sinica pii:10.1038/s41401-018-0172-x [Epub ahead of print].

Fibronectin (FN) is a main component of extracellular matrix (ECM) in most adult tissues. Under pathological conditions, particularly inflammation, wound healing and tumors, an alternatively spliced exon extra domain A (EDA) is included in the FN protein (EDA+FN), which facilitates cellular proliferation, motility, and aggressiveness in different lesions. In this study we investigated the effects of EDA+FN on bone destruction in human radicular cysts and explored the possibility of editing FN gene or blocking the related paracrine signaling pathway to inhibit the osteoclastogenesis. The specimens of radicular cysts were obtained from 20 patients. We showed that the vessel density was positively associated with both the lesion size (R = 0.49, P = 0.001) and EDA+FN staining (R = 0.26, P = 0.022) in the specimens. We isolated fibroblasts from surgical specimens, and used the CRISPR/Cas system to knockout the EDA exon, or used IST-9 antibody and bevacizumab to block EDA+FN and VEGF, respectively. Compared to control fibroblasts, the fibroblasts from radicular cysts exhibited significantly more Trap+MNCs, the relative expression level of VEGF was positively associated with both the ratio of EDA+FN/total FN (R = 0.271, P = 0.019) and with the number of Trap+MNCs (R = 0.331, P = 0.008). The knockout of the EDA exon significantly decreased VEGF expression in the fibroblasts derived from radicular cysts, leading to significantly decreased osteoclastogenesis; similar results were observed using bevacizumab to block VEGF, but block of EDA+FN with IST-9 antibody had no effect. Furthermore, the inhibitory effects of gene editing on Trap+MNC development were restored by exogenous VEGF. These results suggest that EDA+FN facilitates osteoclastogenesis in the fibrous capsule of radicular cysts, through a mechanism mediated by VEGF via an autocrine effect on the fibroblasts. Bevacizumab inhibits osteoclastogenesis in radicular cysts as effectively as the exclusion of the EDA exon by gene editing.

RevDate: 2018-11-14
CmpDate: 2018-11-14

Wight AJ (2018)

Strict EU ruling on gene-edited crops squeezes science.

Nature, 563(7729):15-16.

RevDate: 2018-11-30

Pickett CJ, RW Zeller (2018)

Efficient genome editing using CRISPR-Cas-mediated homology directed repair in the ascidian Ciona robusta.

Genesis (New York, N.Y. : 2000) [Epub ahead of print].

Eliminating or silencing a gene's level of activity is one of the classic approaches developmental biologists employ to determine a gene's function. A recently developed method of gene perturbation called CRISPR-Cas, which was derived from a prokaryotic adaptive immune system, has been adapted for use in eukaryotic cells. This technology has been established in several model organisms as a powerful and efficient tool for knocking out or knocking down the function of a gene of interest. It has been recently shown that CRISPR-Cas functions with fidelity and efficiency in Ciona robusta. Here, we show that in C. robusta CRISPR-Cas mediated genomic knock-ins can be efficiently generated. Electroporating a tissue-specific transgene driving Cas9 and a U6-driven gRNA transgene together with a fluorescent protein-containing homology directed repair (FP-HDR) template results in gene-specific patterns of fluorescence consistent with a targeted genomic insertion. Using the Tyrosinase locus to optimize reagents, we first characterize a new Pol III promoter for expressing gRNAs from the Ciona savignyi H1 gene, and then adapt technology that flanks gRNAs by ribozymes allowing cell-specific expression from Pol II promoters. Next, we examine homology arm-length efficiencies of FP-HDR templates. Reagents were then developed for targeting Brachyury and Pou4 that resulted in expected patterns of fluorescence, and sequenced PCR amplicons derived from single embryos validated predicted genomic insertions. Finally, using two differentially colored FP-HDR templates, we show that biallelic FP-HDR template insertion can be detected in live embryos of the F0 generation.

RevDate: 2018-11-14

England WE, Kim T, RJ Whitaker (2018)

Metapopulation Structure of CRISPR-Cas Immunity in Pseudomonas aeruginosa and Its Viruses.

mSystems, 3(5): pii:mSystems00075-18.

Viruses that infect the widespread opportunistic pathogen Pseudomonas aeruginosa have been shown to influence physiology and critical clinical outcomes in cystic fibrosis (CF) patients. To understand how CRISPR-Cas immune interactions may contribute to the distribution and coevolution of P. aeruginosa and its viruses, we reconstructed CRISPR arrays from a highly sampled longitudinal data set from CF patients attending the Copenhagen Cystic Fibrosis Clinic in Copenhagen, Denmark (R. L. Marvig, L. M. Sommer, S. Molin, and H. K. Johansen, Nat Genet 47:57-64, 2015, https://doi.org/10.1038/ng.3148). We show that new spacers are not added to or deleted from CRISPR arrays over time within a single patient but do vary among patients in this data set. We compared assembled CRISPR arrays from this data set to CRISPR arrays extracted from 726 additional publicly available P. aeruginosa sequences to show that local diversity in this population encompasses global diversity and that there is no evidence for population structure associated with location or environment sampled. We compare over 3,000 spacers from our global data set to 98 lytic and temperate viruses and proviruses and find a subset of related temperate virus clusters frequently targeted by CRISPR spacers. Highly targeted viruses are matched by different spacers in different arrays, resulting in a pattern of distributed immunity within the global population. Understanding the multiple immune contexts that P. aeruginosa viruses face can be applied to study of P. aeruginosa gene transfer, the spread of epidemic strains in cystic fibrosis patients, and viral control of P. aeruginosa infection. IMPORTANCE Pseudomonas aeruginosa is a widespread opportunistic pathogen and a major cause of morbidity and mortality in cystic fibrosis patients. Microbe-virus interactions play a critical role in shaping microbial populations, as viral infections can kill microbial populations or contribute to gene flow among microbes. Investigating how P. aeruginosa uses its CRISPR immune system to evade viral infection aids our understanding of how this organism spreads and evolves alongside its viruses in humans and the environment. Here, we identify patterns of CRISPR targeting and immunity that indicate P. aeruginosa and its viruses evolve in both a broad global population and in isolated human "islands." These data set the stage for exploring metapopulation dynamics occurring within and between isolated "island" populations associated with CF patients, an essential step to inform future work predicting the specificity and efficacy of virus therapy and the spread of invasive viral elements and pathogenic epidemic bacterial strains.

RevDate: 2018-10-27

Šulčius S, Šimoliūnas E, Alzbutas G, et al (2018)

Genomic characterization of cyanophage vB_AphaS-CL131 infecting filamentous diazotrophic cyanobacterium Aphanizomenon flos-aquae reveals novel insights into virus-bacterium interactions.

Applied and environmental microbiology pii:AEM.01311-18 [Epub ahead of print].

While filamentous cyanobacteria play a crucial role in food web dynamics and biogeochemical cycling of many aquatic ecosystems around the globe, the knowledge regarding phages infecting them is limited. Here we describe the complete genome of the virulent cyanophage vB_AphaS-CL131 (CL 131), a Siphoviridae phage that infects filamentous diazotrophic bloom forming cyanobacterium Aphanizomenon flos-aquae in the brackish Baltic Sea. CL 131 features a 112793 bp dsDNA genome, encompassing 149 putative open reading frames (ORFs), of which the majority (86%) lack sequence homology to genes with known functions in other bacteriophages or bacteria. Phylogenetic analysis revealed that CL 131 possibly represents a new evolutionary lineage within the group of cyanophages infecting filamentous cyanobacteria, which form a separate cluster compared to phages infecting unicellular cyanobacteria. CL 131 encodes a putative type V-U2 CRISPR-Cas system with one spacer (out of 10) targeting a DNA primase pseudogene in a cyanobacterium and a putative type II toxin-antitoxin system, consisting of GNAT family N-acetyltransferase and a protein of unknown function containing the PRK09726 domain (characteristic of HipB antitoxins). Comparison of CL 131 proteins to reads from Baltic Sea and other available fresh- and brackish-water metagenomes and analysis of CRISPR-Cas arrays in publicly available A. flos-aquae genomes demonstrated that phages similar to CL 131 are present and dynamic in the Baltic Sea and share common history with their hosts dating back at least several decades. In addition, different CRISPR-Cas systems within individual A. flos-aquae genomes targeted several sequences in the CL 131 genome, including genes related to virion structure and morphogenesis. Altogether, these findings revealed new genomic information for exploring viral diversity and provide a model system for investigation of virus-host interactions in filamentous cyanobacteria.Importance The genomic characterization of novel cyanophage vB_AphaS-CL131 and the analysis of its genomic features in the context of other viruses, metagenomic data and host CRISPR-Cas systems contribute toward better understanding of aquatic viral diversity and distribution in general and brackish water cyanophages infecting filamentous diazotrophic cyanobacteria in the Baltic Sea in particular. The results of this study revealed previously undescribed features of cyanophage genomes (e.g. self-excising intein-containing putative dCTP deaminase, putative cyanophage-encoded CRISPR-Cas and toxin-antitoxin systems) and can therefore be used to predict potential interactions between bloom-forming cyanobacteria and their cyanophages.

RevDate: 2018-11-14

Donà V, V Perreten (2018)

Comparative Genomics of the First and Complete Genome of "Actinobacillus porcitonsillarum" Supports the Novel Species Hypothesis.

International journal of genomics, 2018:5261719.

"Actinobacillus porcitonsillarum" is considered a nonpathogenic member of the Pasteurellaceae family, which phenotypically resembles the pathogen Actinobacillus pleuropneumoniae. Previous studies suggested that "A. porcitonsillarum" may represent a new species closely related to Actinobacillus minor, yet no full genome has been sequenced so far. We implemented the Oxford Nanopore and Illumina sequencing technologies to obtain the highly accurate and complete genome sequence of the "A. porcitonsillarum" strain 9953L55. After validating our de novo assembly strategy by comparing the A. pleuropneumoniae S4074T genome sequence obtained by Oxford Nanopore Technology combined with Illumina reads with a PacBio-sequenced S4074T genome from the NCBI database, we performed comparative analyses of the 9953L55 genome with the A. minor type strain NM305T, A. minor strain 202, and A. pleuropneumoniae S4074T. The 2,263,191 bp circular genome of 9953L55 consisted of 2168 and 2033 predicted genes and proteins, respectively. The lipopolysaccharide cluster resembled the genetic organization of A. pleuropneumoniae serotypes 1, 9, and 11, possibly explaining the positive reactions observed previously in serotyping tests. In contrast to NM305T, we confirmed the presence of a complete apxIICABD operon in 9953L55 and 202 accounting for their hemolytic phenotype and Christie-Atkins-Munch-Petersen (CAMP) reaction positivity. Orthologous gene cluster analysis provided insight into the differential ability of strains of the A. minor/"porcitonsillarum" complex and A. pleuropneumoniae to ferment lactose, raffinose, trehalose, and mannitol. The four strains showed distinct and shared transposable elements, CRISPR/Cas systems, and integrated prophages. Genome comparisons based on average nucleotide identity and in silico DNA-DNA hybridization confirmed the close relationship among strains belonging to the A. minor/"porcitonsillarum" complex compared to other Actinobacillus spp., but also suggested that 9953L55 and 202 belong to the same novel species closely related to A. minor, namely, "A. porcitonsillarum." Recognition of the taxon as a separate species would improve diagnostics and control strategies of pig pleuropneumonia.

RevDate: 2018-10-26

Khambhati K, Bhattacharjee G, V Singh (2018)

Current progress in CRISPR-based diagnostic platforms.

Journal of cellular biochemistry [Epub ahead of print].

The CRISPR-Cas system is a key technology for genome editing and regulation in a wide range of organisms and cell types. Recently, CRISPR-Cas-based diagnostic platform has shown idealistic properties for pathogen detection. Integrating the CRISPR-Cas platform along with lateral flow system allows rapid, sensitive, specific, cheap, and reliable diagnostic. It has the potential to be in frontline for not only pathogen detection during the epidemic outbreak, but also cancer, and genetic diseases.

RevDate: 2018-10-25

Binder WH (2018)

The Past 40 Years of Macromolecular Sciences: Reflections on Challenges in Synthetic Polymer and Material Science.

Macromolecular rapid communications [Epub ahead of print].

Technology and science are often successful in discontinuities ("disruptive innovations" or "leapfrogging"), in turn allowing true, big societal development by entire changes in technology rather than by minuscule stepwise improvements. Examples are the emergence of modern computer science by inventing the field-effect transistor rather than further fine-tuning the "Röhrentransistor"; the development of (organic) light-emitting diodes in advance of the "Gasglühstrumpf"; CRISPR/Cas exceeding any previous genetic method or Ziegler-Natta polymerization enabling stereoregular polypropylene (PP) and high-density polyethylene (HDPE) in advance of free-radical polymerization. Where may the frogs in polymer science in the future "jump" to? Contemplating past achievements in (synthetic) polymer science, such as living polymerization, "click" chemistry, supramolecular chemistry, the potentially "leaping" areas of self-healing and (bio)degradable materials, amyloids, and biomaterials are reflected upon.

RevDate: 2018-10-25

Baliga P, Shekar M, MN Venugopal (2018)

Investigation of direct repeats, spacers and proteins associated with clustered regularly interspaced short palindromic repeat (CRISPR) system of Vibrio parahaemolyticus.

Molecular genetics and genomics : MGG pii:10.1007/s00438-018-1504-8 [Epub ahead of print].

Vibrio parahaemolyticus, a ubiquitous bacterium of the marine environment is an important food-borne pathogen responsible for gastroenteritis worldwide. In this study, we aimed to investigate the occurrence and diversity of the CRISPR-Cas system in V. parahaemolyticus genomes using a bioinformatics approach. The CRISPR-Cas system functions as an adaptive immune system in prokaryotes that provides immunity against foreign genetic elements. In total, 570 genomes V. parahaemolyticus genomes were analyzed of which 200 confirmed for the presence of CRISPR-Cas system. The CRISPR-Cas loci were further analyzed for their repeats, spacers and associated Cas proteins. Among the 200 V. parahaemolyticus strains analyzed, 16 (8%) strains possessed the CRISPR-Cas system of complete subtype I-F, while the remaining 184 (92%) harbored the minimalistic type, a subtype I-F variant. Orphan CRISPR repeats and Cas genes were found in one strain each. The CRISPR-associated direct repeat had an unit length of 28 bases. The number of repeat units in each array ranged from 3 to 5 or 5-41 depending on whether they belonged to the minimalistic or complete subtype-IF CRISPR-Cas system, respectively. Of the 768 spacers analyzed in this study, 295 were found to be unique to V. parahaemolyticus. Homology analysis of the conserved spacers revealed matches to plasmids, phages and gut viruses and self chromosomes. Among the CRISPR-associated proteins, Cas5 and Cas7 proteins were found to be conserved. However, variations were seen in the Cas6 protein, which could be grouped into four different types based on their protein length as well as amino acid composition. We present here the diversity and main features of the CRISPR-Cas system in V. parahaemolyticus, which could provide valuable insights in elucidating the role and mechanism of CRISPR/Cas elements in this pathogen.

RevDate: 2018-11-26
CmpDate: 2018-11-26

Zheng L, Shi J, Y Mu (2018)

Dynamics changes of CRISPR-Cas9 systems induced by high fidelity mutations.

Physical chemistry chemical physics : PCCP, 20(43):27439-27448.

CRISPR-Cas9, a powerful genome editing tool, has widely been applied in biological fields. Since the discovery of CRISPR-Cas9 as an adaptive immune system, it has been gradually modified to perform precise genome editing in eukaryotic cells by creating double-strand breaks. Although it is robust and efficient, the current CRISPR-Cas9 system faces a major flaw: off-target effects, which are not well understood. Several Cas9 mutants show significant improvement, with very low off-target effects; however, they also show relatively lower cleavage efficiency for on-target sequences. In this study, the dynamics of wild-type Cas9 from Streptococcus pyogenes and a high fidelity Cas9 mutant have been explored using molecular dynamics simulations. It was found that the mutations cause decreased electrostatic interactions between Cas9 and the R-loop. Consequently, the flexibility of the tDNA/sgRNA heteroduplex is decreased, which may explain the lower tolerance of mismatches in the heteroduplex region. The mutations also affect the protein dynamics and the correlation networks among Cas9 domains. In mutant Cas9, weakened communications between two catalytic domains as well as a slight opening of the conformation induced by the mutations account for the lower on-target cleavage efficiency and probably the lower off-target efficiency as well. These findings will facilitate more precise Cas9 engineering in future.

RevDate: 2018-11-14

Wang X, Li X, Wang T, et al (2018)

SOX17 regulates uterine epithelial-stromal cross-talk acting via a distal enhancer upstream of Ihh.

Nature communications, 9(1):4421 pii:10.1038/s41467-018-06652-w.

Mammalian pregnancy depends on the ability of the uterus to support embryo implantation. Previous studies reveal the Sox17 gene as a downstream target of the Pgr-Gata2-dependent transcription network that directs genomic actions in the uterine endometrium receptive for embryo implantation. Here, we report that ablating Sox17 in the uterine epithelium impairs leukemia inhibitory factor (LIF) and Indian hedgehog homolog (IHH) signaling, leading to failure of embryo implantation. In vivo deletion of the SOX17-binding region 19 kb upstream of the Ihh locus by CRISPR-Cas technology reduces Ihh expression specifically in the uterus and alters proper endometrial epithelial-stromal interactions, thereby impairing pregnancy. This SOX17-binding interval is also bound by GATA2, FOXA2, and PGR. This cluster of transcription factor binding is common in 737 uterine genes and may represent a key regulatory element essential for uterine epithelial gene expression.

RevDate: 2018-11-09
CmpDate: 2018-11-09

Xu J, Barone S, Zahedi K, et al (2018)

Slc4a8 in the Kidney: Expression, Subcellular Localization and Role in Salt Reabsorption.

Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 50(4):1361-1375.

BACKGROUND/AIMS: The sodium-dependent bicarbonate transporter Slc4a8 (a.k.a NDCBE) mediates the co-transport of sodium and bicarbonate in exchange for chloride. It is abundantly detected in the brain, with low expression levels in the kidney. The cell distribution and subcellular localization of Slc4a8 in the kidney and its role in acid/base and electrolyte homeostasis has been the subject of conflicting reports. There are no conclusive localization or functional studies to pinpoint the location and demonstrate the function of Slc4a8 in the kidney.

METHODS: Molecular techniques, including RT-PCR and in situ hybridization, were performed on kidney sections and tagged epitopes were used to examine the membrane targeting of Slc4a8 in polarized kidney cells. Crispr/Cas9 was used to generate and examine Slc4a8 KO mice.

RESULTS: Zonal distribution and in situ hybridization studies showed very little expression for Slc4a8 (NDCBE) in the cortex or in cortical collecting ducts (CCD). Slc4a8 was predominantly detected in the outer and inner medullary collecting ducts (OMCD and IMCD), and was targeted to the basolateral membrane of osmotically tolerant MDCK cells. Slc4a8 KO mice did not show any abnormal salt or bicarbonate wasting under baseline conditions or in response to bicarbonate loading, salt restriction or furosemide-induced diuresis.

CONCLUSION: Slc4a8 (NDCBE) is absent in the CCD and is predominantly localized on the basolateral membrane of medullary collecting duct cells. Further, Slc4a8 deletion does not cause significant acid base or electrolyte abnormalities in pathophysiologic states. Additional studies are needed to examine the role of Slc4a8 (NDCBE) in intracellular pH and volume regulation in medullary collecting duct cells.

RevDate: 2018-11-13
CmpDate: 2018-11-13

Pasricha SR, H Drakesmith (2018)

Hemoglobinopathies in the Fetal Position.

The New England journal of medicine, 379(17):1675-1677.

RevDate: 2018-10-25

Yu N, Yang J, Mishina Y, et al (2018)

Genome Editing: A New Horizon for Oral and Craniofacial Research.

Journal of dental research [Epub ahead of print].

Precise and efficient genetic manipulations have enabled researchers to understand gene functions in disease and development, providing a platform to search for molecular cures. Over the past decade, the unprecedented advancement of genome editing techniques has revolutionized the biological research fields. Early genome editing strategies involved many naturally occurring nucleases, including meganucleases, zinc finger nucleases, and transcription activator-like effector-based nucleases. More recently, the clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated nucleases (CRISPR/Cas) system has greatly enriched genetic manipulation methods in conducting research. Those nucleases generate double-strand breaks in the target gene sequences and then utilize DNA repair mechanisms to permit precise yet versatile genetic manipulations. The oral and craniofacial field harbors a plethora of diseases and developmental defects that require genetic models that can exploit these genome editing techniques. This review provides an overview of the genome editing techniques, particularly the CRISPR/Cas9 technique, for the oral and craniofacial research community. We also discuss the details about the emerging applications of genome editing in oral and craniofacial biology.

RevDate: 2018-11-14

Waghulde H, Cheng X, Galla S, et al (2018)

Attenuation of Microbiotal Dysbiosis and Hypertension in a CRISPR/Cas9 Gene Ablation Rat Model of GPER1.

Hypertension (Dallas, Tex. : 1979), 72(5):1125-1132.

G-protein-coupled estrogen receptor, Gper1, has been implicated in cardiovascular disease, but its mechanistic role in blood pressure control is poorly understood. Here, we demonstrate that genetically salt-sensitive hypertensive rats with complete genomic excision of Gper1 by a multiplexed guide RNA CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 (CRISPR associated proteins) approach present with lower blood pressure, which was accompanied by altered microbiota, different levels of circulating short chain fatty acids, and improved vascular relaxation. Microbiotal transplantation from hypertensive Gper1+/+ rats reversed the cardiovascular protective effect exerted by the genomic deletion of Gper1. Thus, this study reveals a role for Gper1 in promoting microbiotal alterations that contribute to cardiovascular pathology. However, the exact mechanism by which Gper1 regulates blood pressure is still unknown. Our results indicate that the function of Gper1 is contextually dependent on the microbiome, whereby, contemplation of using Gper1 as a target for therapy of cardiovascular disease requires caution.

RevDate: 2018-11-26
CmpDate: 2018-11-26

Majeed M, Soliman H, Kumar G, et al (2018)

Editing the genome of Aphanomyces invadans using CRISPR/Cas9.

Parasites & vectors, 11(1):554 pii:10.1186/s13071-018-3134-8.

BACKGROUND: The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) system is increasingly being used for genome editing experiments. It is a system to add, delete and/or replace parts of a gene in situ in a time- and cost-efficient manner. The genome of many organisms has been edited using this system. We tested the CRISPR/Cas9 system in Aphanomyces invadans, an oomycete, which is the causative agent of epizootic ulcerative syndrome (EUS) in many fish species. Extracellular proteases produced by this oomycete are believed to play a role in EUS virulence.

METHODS: We designed three single guide-RNAs (gRNA) to target A. invadans serine protease gene. These gRNAs were individually combined with the Cas9 to form ribo-nucleo-protein (RNP) complex. A. invadans protoplasts were then transfected with RNP complexes. After the transfection, the target gene was amplified and subjected to sequencing. Zoospores of A. invadans were also transfected with the RNP complex. Three groups of dwarf gourami (Trichogaster lalius) were then experimentally inoculated with (i) non-treated A. invadans zoospores; (ii) RNP-treated A. invadans zoospores; and (iii) autoclaved pond water as negative control, to investigate the effect of edited serine protease gene on the virulence of A. invadans in vivo.

RESULTS: Fluorescence microscopy showed sub-cellular localization of RNP complex in A. invadans protoplasts and zoospores. Sequencing results from the protoplast DNA revealed a point mutation in the target gene. A matching mutation was also detected in zoospores after similar treatment with the same RNP complex. In vivo results showed that the CRISPR/Cas9-treated A. invadans zoospores did not produce EUS clinical signs in the fish. These results were then confirmed by histopathological staining of the muscle sections using Gomori's methenamine silver nitrate and hematoxylin and eosin stains.

CONCLUSIONS: Results obtained in this study indicate that the RNP complex caused effective mutation in the target gene. This hindered the production of serine protease, which ultimately impeded the manifestation of EUS in the fish. Our methods thus establish a promising approach for functional genomics studies in A. invadans and provide novel avenues to develop effective strategies to control this pathogen.

RevDate: 2018-11-14

Lee HW (2018)

Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript.

Molecules and cells, 41(10):917-922.

The CRISPR-Cas system is a well-established RNA-guided DNA editing technique widely used to modify genomic DNA sequences. I used the CRISPR-Cas9 system to change the second and third nucleotides of the triplet TCT of human TNSFSF9 in HepG2 cells to TAG to create an amber stop codon. The TCT triplet is the codon for Ser at the 172nd position of TNSFSF9. The two substituted nucleotides, AG, were confirmed by DNA sequencing of the PCR product followed by PCR amplification of the genomic TNFSF9 gene. Interestingly, sequencing of the cDNA of transcripts of the edited TNFSF9 gene revealed that the TAG had been re-edited to the wild type triplet TCT, and 1 or 2 bases just before the triplet had been deleted. These observations indicate that CRISPR-Cas9-mediated editing of bases in target genomic DNA can be followed by spontaneous re-editing (correcting) of the bases during transcription.

RevDate: 2018-11-19

Markusková B, Lichvariková A, Szemes T, et al (2018)

Genome analysis of lactic acid bacterial strains selected as potential starters for traditional Slovakian bryndza cheese.

FEMS microbiology letters, 365(23):.

Genomes of 21 strains of lactic acid bacteria isolated from Slovakian traditional cheeses were sequenced on an Illumina MiSeq platform. Subsequently, they were analysed regarding taxonomic classification, presence of genes encoding defence systems, antibiotic resistance and production of biogenic amines. Thirteen strains were found to carry genes encoding at least one bacteriocin, 18 carried genes encoding at least one restriction-modification system, all strains carried 1-6 prophages and 9 strains had CRISPR-Cas systems. CRISPR-Cas type II-A was the most common, containing 0-24 spacers. Only 10% spacers were found to be homological to known bacteriophage or plasmid sequences in databases. Two Enterococcus faecium strains and a Lactococcus lactis strain carried antibiotic resistance genes. Genes encoding for ornithine decarboxylase were detected in four strains and genes encoding for agmatine deiminase were detected in four strains. Lactobacillus paraplantarum 251 L appeared to be the most interesting strain, as it contained genes encoding for two bacteriocins, a restriction-modification system, two CRISPR-Cas systems, four prophages and no genes connected with antibiotic resistance or production of biogenic amines.

RevDate: 2018-11-14

Yao R, Liu D, Jia X, et al (2018)

CRISPR-Cas9/Cas12a biotechnology and application in bacteria.

Synthetic and systems biotechnology, 3(3):135-149 pii:S2405-805X(18)30056-5.

CRISPR-Cas technologies have greatly reshaped the biology field. In this review, we discuss the CRISPR-Cas with a particular focus on the associated technologies and applications of CRISPR-Cas9 and CRISPR-Cas12a, which have been most widely studied and used. We discuss the biological mechanisms of CRISPR-Cas as immune defense systems, recently-discovered anti-CRISPR-Cas systems, and the emerging Cas variants (such as xCas9 and Cas13) with unique characteristics. Then, we highlight various CRISPR-Cas biotechnologies, including nuclease-dependent genome editing, CRISPR gene regulation (including CRISPR interference/activation), DNA/RNA base editing, and nucleic acid detection. Last, we summarize up-to-date applications of the biotechnologies for synthetic biology and metabolic engineering in various bacterial species.

RevDate: 2018-11-21

Mohr G, Silas S, Stamos JL, et al (2018)

A Reverse Transcriptase-Cas1 Fusion Protein Contains a Cas6 Domain Required for Both CRISPR RNA Biogenesis and RNA Spacer Acquisition.

Molecular cell, 72(4):700-714.e8.

Prokaryotic CRISPR-Cas systems provide adaptive immunity by integrating portions of foreign nucleic acids (spacers) into genomic CRISPR arrays. Cas6 proteins then process CRISPR array transcripts into spacer-derived RNAs (CRISPR RNAs; crRNAs) that target Cas nucleases to matching invaders. We find that a Marinomonas mediterranea fusion protein combines three enzymatic domains (Cas6, reverse transcriptase [RT], and Cas1), which function in both crRNA biogenesis and spacer acquisition from RNA and DNA. We report a crystal structure of this divergent Cas6, identify amino acids required for Cas6 activity, show that the Cas6 domain is required for RT activity and RNA spacer acquisition, and demonstrate that CRISPR-repeat binding to Cas6 regulates RT activity. Co-evolution of putative interacting surfaces suggests a specific structural interaction between the Cas6 and RT domains, and phylogenetic analysis reveals repeated, stable association of free-standing Cas6s with CRISPR RTs in multiple microbial lineages, indicating that a functional interaction between these proteins preceded evolution of the fusion.

RevDate: 2018-11-02

Dillard KE, Brown MW, Johnson NV, et al (2018)

Assembly and Translocation of a CRISPR-Cas Primed Acquisition Complex.

Cell, 175(4):934-946.e15.

CRISPR-Cas systems confer an adaptive immunity against viruses. Following viral injection, Cas1-Cas2 integrates segments of the viral genome (spacers) into the CRISPR locus. In type I CRISPR-Cas systems, efficient "primed" spacer acquisition and viral degradation (interference) require both the Cascade complex and the Cas3 helicase/nuclease. Here, we present single-molecule characterization of the Thermobifida fusca (Tfu) primed acquisition complex (PAC). We show that TfuCascade rapidly samples non-specific DNA via facilitated one-dimensional diffusion. Cas3 loads at target-bound Cascade and the Cascade/Cas3 complex translocates via a looped DNA intermediate. Cascade/Cas3 complexes stall at diverse protein roadblocks, resulting in a double strand break at the stall site. In contrast, Cas1-Cas2 samples DNA transiently via 3D collisions. Moreover, Cas1-Cas2 associates with Cascade and translocates with Cascade/Cas3, forming the PAC. PACs can displace different protein roadblocks, suggesting a mechanism for long-range spacer acquisition. This work provides a molecular basis for the coordinated steps in CRISPR-based adaptive immunity.

RevDate: 2018-11-14

Van Houdt R, Provoost A, Van Assche A, et al (2018)

Cupriavidus metallidurans Strains with Different Mobilomes and from Distinct Environments Have Comparable Phenomes.

Genes, 9(10): pii:genes9100507.

Cupriavidus metallidurans has been mostly studied because of its resistance to numerous heavy metals and is increasingly being recovered from other environments not typified by metal contamination. They host a large and diverse mobile gene pool, next to their native megaplasmids. Here, we used comparative genomics and global metabolic comparison to assess the impact of the mobilome on growth capabilities, nutrient utilization, and sensitivity to chemicals of type strain CH34 and three isolates (NA1, NA4 and H1130). The latter were isolated from water sources aboard the International Space Station (NA1 and NA4) and from an invasive human infection (H1130). The mobilome was expanded as prophages were predicted in NA4 and H1130, and a genomic island putatively involved in abietane diterpenoids metabolism was identified in H1130. An active CRISPR-Cas system was identified in strain NA4, providing immunity to a plasmid that integrated in CH34 and NA1. No correlation between the mobilome and isolation environment was found. In addition, our comparison indicated that the metal resistance determinants and properties are conserved among these strains and thus maintained in these environments. Furthermore, all strains were highly resistant to a wide variety of chemicals, much broader than metals. Only minor differences were observed in the phenomes (measured by phenotype microarrays), despite the large difference in mobilomes and the variable (shared by two or three strains) and strain-specific genomes.

RevDate: 2018-11-22

Zhou L, Peng R, Zhang R, et al (2018)

The applications of CRISPR/Cas system in molecular detection.

Journal of cellular and molecular medicine, 22(12):5807-5815.

The Streptococcus pyogenes CRISPR/Cas system has found widespread applications as a gene-editing and regulatory tool for the simultaneous delivery of the Cas9 protein and guide RNAs into the cell, thus making the recognition of specific DNA sequences possible. The recent study that shows that Cas9 can also bind to and cleave RNA in an RNA-programmable manner is suggestive of potential utility of this system as a universal nucleic-acid recognition tool. To increase the signal intensity of the CRISPR/Cas system, a signal amplification technique has to be exploited appropriately; this requirement is also a challenge for the detection of DNA or RNA. Furthermore, the CRISPR/Cas system may be used to detect point mutations or single-nucleotide variants because of the specificity of the recognition between the target sequence and the CRISPR/Cas system. These lines of evidence make this technique capable of detecting pathogens during infection via analysis of their DNA or RNA. Thus, here we summarize applications of the CRISPR/Cas system to the recognition and detection of DNA and RNA molecules as well as the signal amplification. We also describe its potential ability to detect mutations and single-nucleotide variants. Finally, we sum up its applications to testing for pathogens and potential barriers for its implementation.

RevDate: 2018-11-14

Parise D, Parise MTD, Viana MVC, et al (2018)

First genome sequencing and comparative analyses of Corynebacterium pseudotuberculosis strains from Mexico.

Standards in genomic sciences, 13:21 pii:325.

Corynebacterium pseudotuberculosis is a pathogenic bacterium which has been rapidly spreading all over the world, causing economic losses in the agricultural sector and sporadically infecting humans. Six C. pseudotuberculosis strains were isolated from goats, sheep, and horses with distinct abscess locations. For the first time, Mexican genomes of this bacterium were sequenced and studied in silico. All strains were sequenced using Ion Personal Genome Machine sequencer, assembled using Newbler and SPAdes software. The automatic genome annotation was done using the software RAST and in-house scripts for transference, followed by manual curation using Artemis software and BLAST against NCBI and UniProt databases. The six genomes are publicly available in NCBI database. The analysis of nucleotide sequence similarity and the generated phylogenetic tree led to the observation that the Mexican strains are more similar between strains from the same host, but the genetic structure is probably more influenced by transportation of animals between farms than host preference. Also, a putative drug target was predicted and in silico analysis of 46 strains showed two gene clusters capable of differentiating the biovars equi and ovis: Restriction Modification system and CRISPR-Cas cluster.

RevDate: 2018-11-19

Harrington LB, Burstein D, Chen JS, et al (2018)

Programmed DNA destruction by miniature CRISPR-Cas14 enzymes.

Science (New York, N.Y.), 362(6416):839-842.

CRISPR-Cas systems provide microbes with adaptive immunity to infectious nucleic acids and are widely employed as genome editing tools. These tools use RNA-guided Cas proteins whose large size (950 to 1400 amino acids) has been considered essential to their specific DNA- or RNA-targeting activities. Here we present a set of CRISPR-Cas systems from uncultivated archaea that contain Cas14, a family of exceptionally compact RNA-guided nucleases (400 to 700 amino acids). Despite their small size, Cas14 proteins are capable of targeted single-stranded DNA (ssDNA) cleavage without restrictive sequence requirements. Moreover, target recognition by Cas14 triggers nonspecific cutting of ssDNA molecules, an activity that enables high-fidelity single-nucleotide polymorphism genotyping (Cas14-DETECTR). Metagenomic data show that multiple CRISPR-Cas14 systems evolved independently and suggest a potential evolutionary origin of single-effector CRISPR-based adaptive immunity.

RevDate: 2018-11-20

Gong T, Tang B, Zhou X, et al (2018)

Genome editing in Streptococcus mutans through self-targeting CRISPR arrays.

Molecular oral microbiology, 33(6):440-449.

Streptococcus mutans is the primary etiological agent of human dental caries. Its major virulence factors, glucosyltransferases (Gtfs), utilize sucrose to synthesize extracellular polysaccharides (EPS), leading to the formation of dental plaque biofilm. The current study was designed to develop a novel self-targeting gene editing technology that targeted gtfs to inhibit biofilms formation. The CRISPR-Cas system (ie, clustered regularly interspaced short palindromic repeat, with CRISPR-associated proteins) provides sequence-specific protection against foreign genetic materials in archaea and bacteria, and has been widely developed for genomic engineering. The first aim of this study was to test whether components of the CRISPR-Cas9 system from S mutans UA159 is necessary to defend against foreign DNA. The data showed that a suitable PAM site, tracrRNA, Cas9, and RNase III are indispensable elements to perform normal function of S mutans CRISPR-Cas9 system. Based on these results, we designed self-targeting CRISPR arrays (containing spacer sequences identifying with gtfB) and cloned them onto plasmids. Afterward, we transformed the plasmids and editing templates into UA159 (self-targeting) to acquire desired mutants. Our data showed that this technology performed well and was able to successfully edit gtfB or gtfBgtfC genes. This resulted in high reduction in EPS synthesis and was able to breakdown biofilm formation, which is also a promising tool for dental clinics in order to prevent the formation of S mutans biofilms in the future.

RevDate: 2018-10-18

Dong C, Fontana J, Patel A, et al (2018)

Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria.

Nature communications, 9(1):4318 pii:10.1038/s41467-018-06909-4.

In the original version of the Supplementary Information file associated with this Article, the sequence '1x MS2 scRNA.b2' was incorrectly given as 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT' and should have read 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACATGAGGATCACCCATGTGCTTTTTTT'. The error has now been fixed and the corrected version of the Supplementary Information PDF is available to download from the HTML version of the Article.

RevDate: 2018-11-14

Lone BA, Karna SKL, Ahmad F, et al (2018)

CRISPR/Cas9 System: A Bacterial Tailor for Genomic Engineering.

Genetics research international, 2018:3797214.

Microbes use diverse defence strategies that allow them to withstand exposure to a variety of genome invaders such as bacteriophages and plasmids. One such defence strategy is the use of RNA guided endonuclease called CRISPR-associated (Cas) 9 protein. The Cas9 protein, derived from type II CRISPR/Cas system, has been adapted as a versatile tool for genome targeting and engineering due to its simplicity and high efficiency over the earlier tools such as ZFNs and TALENs. With recent advancements, CRISPR/Cas9 technology has emerged as a revolutionary tool for modulating the genome in living cells and inspires innovative translational applications in different fields. In this paper we review the developments and its potential uses in the CRISPR/Cas9 technology as well as recent advancements in genome engineering using CRISPR/Cas9.

RevDate: 2018-11-26

Bron PA, Marcelli B, Mulder J, et al (2018)

Renaissance of traditional DNA transfer strategies for improvement of industrial lactic acid bacteria.

Current opinion in biotechnology, 56:61-68 pii:S0958-1669(18)30106-X [Epub ahead of print].

The ever-expanding genomic insight in natural diversity of lactic acid bacteria (LAB) has revived the industrial interest in traditional and natural genetic mobilization methodologies. Here, we review recent advances in horizontal gene transfer processes in LAB, including natural competence, conjugation, and phage transduction. In addition, we envision the possibilities for industrial strain improvement arising from the recent discoveries of molecular exchanges between bacteria through nanotubes and extracellular vesicles, as well as the constantly expanding genome editing possibilities using the CRISPR-Cas technology.

RevDate: 2018-10-09

Villiger L, Grisch-Chan HM, Lindsay H, et al (2018)

Treatment of a metabolic liver disease by in vivo genome base editing in adult mice.

Nature medicine, 24(10):1519-1525.

CRISPR-Cas-based genome editing holds great promise for targeting genetic disorders, including inborn errors of hepatocyte metabolism. Precise correction of disease-causing mutations in adult tissues in vivo, however, is challenging. It requires repair of Cas9-induced double-stranded DNA (dsDNA) breaks by homology-directed mechanisms, which are highly inefficient in nondividing cells. Here we corrected the disease phenotype of adult phenylalanine hydroxylase (Pah)enu2 mice, a model for the human autosomal recessive liver disease phenylketonuria (PKU)1, using recently developed CRISPR-Cas-associated base editors2-4. These systems enable conversion of C∙G to T∙A base pairs and vice versa, independent of dsDNA break formation and homology-directed repair (HDR). We engineered and validated an intein-split base editor, which allows splitting of the fusion protein into two parts, thereby circumventing the limited cargo capacity of adeno-associated virus (AAV) vectors. Intravenous injection of AAV-base editor systems resulted in Pahenu2 gene correction rates that restored physiological blood phenylalanine (L-Phe) levels below 120 µmol/l [5]. We observed mRNA correction rates up to 63%, restoration of phenylalanine hydroxylase (PAH) enzyme activity, and reversion of the light fur phenotype in Pahenu2 mice. Our findings suggest that targeting genetic diseases in vivo using AAV-mediated delivery of base-editing agents is feasible, demonstrating potential for therapeutic application.

RevDate: 2018-10-23
CmpDate: 2018-10-23

Tomlinson T (2018)

A Crispr Future for Gene-Editing Regulation: a Proposal for an Updated Biotechnology Regulatory System in an Era of Human Genomic Editing.

Fordham law review, 87(1):437-483.

Recent developments in gene-editing technology have enabled scientists to manipulate the human genome in unprecedented ways. One technology in particular, Clustered Regularly Interspaced Short Pallindromic Repeat (CRISPR), has made gene editing more precise and cost-effective than ever before. Indeed, scientists have already shown that CRISPR can eliminate genes linked to life-threatening diseases from an individual's genetic makeup and, when used on human embryos, CRISPR has the potential to permanently eliminate hereditary diseases from the human genome in its entirety. These developments have brought great hope to individuals and their families, who suffer from genetically linked diseases. But there is a dark side: in the wrong hands, CRISPR could negatively impact the course of human evolution or be used to create biological weaponry. Despite these possible consequences, CRISPR remains largely unregulated due to the United States's outdated regulatory scheme for biotechnology. Moreover, human embryo research, which is likely critical to maximizing the therapeutic applications of CRISPR, is not easily undertaken by scientists due to a number of federal and state restrictions aimed at preventing such research. This Note examines the possible benefits and consequences of CRISPR and discusses the current regulations in both the fields of biotechnology and human embryo research that hamper the government's ability to effectively regulate this technology. Ultimately, this Note proposes a new regulatory scheme for biotechnology that focuses on the processes used to create products using CRISPR, rather than the products themselves, with a focus on enabling ethical research using human embryos to maximize the potential benefits of CRISPR.

RevDate: 2018-11-21

Du L, Zhou A, Sohr A, et al (2018)

An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing.

Journal of visualized experiments : JoVE.

Binary transcription systems are powerful genetic tools widely used for visualizing and manipulating cell fate and gene expression in specific groups of cells or tissues in model organisms. These systems contain two components as separate transgenic lines. A driver line expresses a transcriptional activator under the control of tissue-specific promoters/enhancers, and a reporter/effector line harbors a target gene placed downstream to the binding site of the transcription activator. Animals harboring both components induce tissue-specific transactivation of a target gene expression. Precise spatiotemporal expression of the gene in targeted tissues is critical for unbiased interpretation of cell/gene activity. Therefore, developing a method for generating exclusive cell/tissue-specific driver lines is essential. Here we present a method to generate highly tissue-specific targeted expression system by employing a "Clustered Regularly Interspaced Short Palindromic Repeat/CRISPR-associated" (CRISPR/Cas)-based genome editing technique. In this method, the endonuclease Cas9 is targeted by two chimeric guide RNAs (gRNA) to specific sites in the first coding exon of a gene in the Drosophila genome to create double-strand breaks (DSB). Subsequently, using an exogenous donor plasmid containing the transactivator sequence, the cell-autonomous repair machinery enables homology-directed repair (HDR) of the DSB, resulting in precise deletion and replacement of the exon with the transactivator sequence. The knocked-in transactivator is expressed exclusively in cells where the cis-regulatory elements of the replaced gene are functional. The detailed step-by-step protocol presented here for generating a binary transcriptional driver expressed in Drosophila fgf/branchless-producing epithelial/neuronal cells can be adopted for any gene- or tissue-specific expression.

RevDate: 2018-10-08

Ali Q (2018)

Non-conventional therapeutic technique to replace CRISPR bacteria from biofilm by inducible lysogen.

Journal of biological dynamics [Epub ahead of print].

Bacteriophage can be an effective means of regulating bacterial populations when conditions allow phage invasion of bacterial colonies. Phage can either infect and lyse a host cell, or insert their DNA into the host cell genome; the latter process is called lysogeny. The clustered regularly interspaced short palindromic repeat (CRISPR) system, linked with CRISPR-associated (Cas) genes, is a regulatory system present in a variety of bacteria which confers immunity against bacteriophage. Studies of the group behaviour of bacteria with CRISPR/Cas systems have provided evidence that CRISPR in lysogenized bacteria can cause an inability to form biofilm. This allows CRISPR-immune bacteria in biofilms to effectively resist phage therapy. Our recent work has described a potential therapeutic technique to eradicate CRISPR-immune bacteria from a biofilm by a continuous influx of lysogens carrying an identical phage sequence. However, this model predicted that the CRISPR-immune population could persist for long times before eradication. Our current focus is on the use of diverse lysogens against CRISPR-capable bacterial populations. The goal of this work is to find a suitable strategy which can eradicate bacteria with a CRISPR system through the influx of finite amounts of distinct lysogens over fixed intervals.

RevDate: 2018-10-05

Chen S, Liu H, Liang W, et al (2018)

Insert sequences of CRISPR/Cas system regulate horizontal antibiotic gene transfer in Shigella.

International journal of antimicrobial agents pii:S0924-8579(18)30279-6 [Epub ahead of print].

Multidrug resistances Shigella is an enormous threat of public health. The resistance genes always located in plasmids, phages and integrons, which get into bacteria cells by horizontal gene transfer (HGT). CRISPR-Cas systems are adaptive immune systems in bacteria that are beneficial to resist phage infection and other mobile genetic elements. But this can come at a cost of inhibiting the acquisition of other beneficial genes through HGT. Here, we investigate how Shigella regulate the activity of the CRISPR/Cas system spontaneously, when it wants acquire exogenous gene that is necessary for its survival. We found that IS elements were identified in cas genes, such as IS600 in cse2, ISSfl2 in cas6e, IS629 in cse1- cas3. The number of spacers in CRISPR/Cas which strain containing IS was fewer compare with none IS. Interestingly, fewer spacers were also found in multi-drug resistance Shigella strains. Furthermore, we have constructed the genetic transferred antibiotic resistant strain by resistance plasmid transfer, to detect the CRISPR/Cas system changes in this two group strains. We found that cse2 gene had a new IS elements (IS600) in the antibiotic-resistant strain. The bioinformatics analyses showed that the IS600 insert hotspots in the cse2 gene were the TGC-GGC gene motifs and the tertiary structure of the Cse2 protein was different with IS600 or not. IS600 could bring a 5-order of magnitude (105) decrease in the relative expression of cse2 gene. This study has significant implication for further revealing the mechanism underlying the CRISPR/Cas-mediated antibiotic resistance gene horizontal transfer in Shigella.

RevDate: 2018-11-14

Tashkandi M, Ali Z, Aljedaani F, et al (2018)

Engineering resistance against Tomato yellow leaf curl virus via the CRISPR/Cas9 system in tomato.

Plant signaling & behavior, 13(10):e1525996.

CRISPR/Cas systems confer molecular immunity against phages and conjugative plasmids in prokaryotes. Recently, CRISPR/Cas9 systems have been used to confer interference against eukaryotic viruses. Here, we engineered Nicotiana benthamiana and tomato (Solanum lycopersicum) plants with the CRISPR/Cas9 system to confer immunity against the Tomato yellow leaf curl virus (TYLCV). Targeting the TYLCV genome with Cas9-single guide RNA at the sequences encoding the coat protein (CP) or replicase (Rep) resulted in efficient virus interference, as evidenced by low accumulation of the TYLCV DNA genome in the transgenic plants. The CRISPR/Cas9-based immunity remained active across multiple generations in the N. benthamiana and tomato plants. Together, our results confirmed the efficiency of the CRISPR/Cas9 system for stable engineering of TYLCV resistance in N. benthamiana and tomato, and opens the possibilities of engineering virus resistance against single and multiple infectious viruses in other crops.

RevDate: 2018-11-14
CmpDate: 2018-11-05

Howells RM, Craze M, Bowden S, et al (2018)

Efficient generation of stable, heritable gene edits in wheat using CRISPR/Cas9.

BMC plant biology, 18(1):215 pii:10.1186/s12870-018-1433-z.

BACKGROUND: The use of CRISPR/Cas9 systems could prove to be a valuable tool in crop research, providing the ability to fully knockout gene function in complex genomes or to precisely adjust gene function by knockout of individual alleles.

RESULTS: We compare gene editing in hexaploid wheat (Triticum aestivum) with diploid barley (Hordeum vulgare), using a combination of single genome and tri-genome targeting. High efficiency gene editing, 11-17% for single genome targeted guides and 5% for tri-genome targeted guides, was achieved in wheat using stable Agrobacterium-mediated transformation. Gene editing in wheat was shown to be predominantly heterozygous, edits were inherited in a Mendelian fashion over multiple generations and no off-target effects were observed. Comparison of editing between the two species demonstrated that more stable, heritable edits were produced in wheat, whilst barley exhibited continued and somatic editing.

CONCLUSION: Our work shows the potential to obtain stable edited transgene-free wheat lines in 36 weeks through only two generations and that targeted mutagenesis of individual homeologues within the wheat genome is achievable with a modest amount of effort, and without off-target mutations or the need for lengthy crossing strategies.

RevDate: 2018-10-09

Smith CIE, R Zain (2018)

Therapeutic Oligonucleotides: State of the Art.

Annual review of pharmacology and toxicology [Epub ahead of print].

Oligonucleotides (ONs) can interfere with biomolecules representing the entire extended central dogma. Antisense gapmer, steric block, spliceswitching ONs, and short interfering RNA drugs have been successfully developed. Moreover, antagomirs (antimicroRNAs), microRNA mimics, aptamers, DNAdecoys, DNAzymes, synthetic guide strands for CRISPR/Cas, and innate immunity-stimulating ONs are all in clinical trials. DNAtargeting, triplex-forming ONs and strand-invading ONs have made their mark on drug development research, but not yet as medicines. Both design and synthetic nucleic acid chemistry are crucial for achieving biologically active ONs. The dominating modifications are phosphorothioate linkages, base methylation, and numerous 2'-substitutions in the furanose ring, such as 2'-fluoro, O-methyl, or methoxyethyl. Locked nucleic acid and constrained ethyl, a related variant, are bridged forms where the 2'-oxygen connects to the 4'-carbon in the sugar. Phosphorodiamidate morpholino oligomers, carrying a modified heterocyclic backbone ring, have also been commercialized. Delivery remains a major obstacle, but systemic administration and intrathecal infusion are used for treatment of the liver and brain, respectively. Expected final online publication date for the Annual Review of Pharmacology and Toxicology Volume 59 is January 6, 2019. Please see http://www.annualreviews.org/page/journal/pubdates for revised estimates.

RevDate: 2018-11-01

Majumdar S, MP Terns (2018)

CRISPR RNA-guided DNA cleavage by reconstituted Type I-A immune effector complexes.

Extremophiles : life under extreme conditions pii:10.1007/s00792-018-1057-0 [Epub ahead of print].

Diverse CRISPR-Cas immune systems protect archaea and bacteria from viruses and other mobile genetic elements. All CRISPR-Cas systems ultimately function by sequence-specific destruction of invading complementary nucleic acids. However, each CRISPR system uses compositionally distinct crRNP [CRISPR (cr) RNA/Cas protein] immune effector complexes to recognize and destroy invasive nucleic acids by unique molecular mechanisms. Previously, we found that Type I-A (Csa) effector crRNPs from Pyrococcus furiosus function in vivo to eliminate invader DNA. Here, we reconstituted functional Type I-A effector crRNPs in vitro with recombinant Csa proteins and synthetic crRNA and characterized properties of crRNP assembly, target DNA recognition and cleavage. Six proteins (Csa 4-1, Cas3″, Cas3', Cas5a, Csa2, Csa5) are essential for selective target DNA binding and cleavage. Native gel shift analysis and UV-induced RNA-protein crosslinking demonstrate that Cas5a and Csa2 directly interact with crRNA 5' tag and guide sequences, respectively. Mutational analysis revealed that Cas3″ is the effector nuclease of the complex. Together, our results indicate that DNA cleavage by Type I-A crRNPs requires crRNA-guided and protospacer adjacent motif-dependent target DNA binding to unwind double-stranded DNA and expose single strands for progressive ATP-dependent 3'-5' cleavage catalyzed by integral Cas3' helicase and Cas3″ nuclease crRNP components.

RevDate: 2018-11-14

Terceti MS, Vences A, Matanza XM, et al (2018)

Molecular Epidemiology of Photobacterium damselae subsp. damselae Outbreaks in Marine Rainbow Trout Farms Reveals Extensive Horizontal Gene Transfer and High Genetic Diversity.

Frontiers in microbiology, 9:2155.

The marine bacterium Photobacterium damselae subsp. damselae is a pathogen for a variety of marine animals, as well as for humans, and is nowadays considered an emerging pathogen for fish of importance in marine aquaculture. Recent studies have suggested that outbreaks in fish farms are caused by multiclonal populations of this subspecies that exist in the environment. Here, we report the study of a collection of 31 strains isolated during the course of disease outbreaks in marine rainbow trout farms in Denmark in 1994, 1995, and 2006, respectively. A phylogenetic analysis based on the toxR gene sequence, and the screening of virulence-related genes uncovered a high genetic heterogeneity, even among strains isolated from the same fish farm at the same time. Moreover, comparative analysis of the whole genome sequences of four selected strains revealed a large number of differentially occurring genes, which included virulence genes, pPHDD1 plasmid, polysaccharide synthesis gene clusters, CRISPR-Cas systems and putative new mobile genetic elements. This study provides sound evidence that P. damselae subsp. damselae outbreaks in Danish rainbow trout farms were caused by multiclonal populations and that horizontal gene transfer constitutes a strong driving force in the generation of intraspecific diversity in this pathogen.

RevDate: 2018-11-28

Hasan MH, Davis LE, Bollavarapu RK, et al (2018)

Dynamin Is Required for Efficient Cytomegalovirus Maturation and Envelopment.

Journal of virology, 92(24): pii:JVI.01418-18.

Cytomegalovirus secondary envelopment occurs in a virus-induced cytoplasmic assembly compartment (vAC) generated via a drastic reorganization of the membranes of the secretory and endocytic systems. Dynamin is a eukaryotic GTPase that is implicated in membrane remodeling and endocytic membrane fission events; however, the role of dynamin in cellular trafficking of viruses beyond virus entry is only partially understood. Mouse embryonic fibroblasts (MEF) engineered to excise all three isoforms of dynamin were infected with mouse cytomegalovirus (MCMV-K181). Immediate-early (IE1; m123) viral protein was detected in these triple dynamin knockout (TKO) cells, as well as in mock-induced parental MEF, at early times postinfection, although levels were reduced in TKO cells, indicating that virus entry was affected but not eliminated. Levels of IE1 protein and another viral early protein (m04) were normalized by 48 h postinfection; however, late protein (m55; gB) expression was reduced in infected TKO cells compared to parental MEF. Ultrastructural analysis revealed intact stages of nuclear virus maturation in both cases with equivalent numbers of nucleocapsids containing packaged viral DNA (C-capsids), indicating successful viral DNA replication, capsid assembly, and genome packaging. Most importantly, severe defects in virus envelopment were visualized in TKO cells but not in parental cells. Dynamin inhibitor (dynasore)-treated MEF showed a phenotype similar to TKO cells upon mouse cytomegalovirus infection, confirming the role of dynamin in late maturation processes. In summary, dynamin-mediated endocytic pathways are critical for the completion of cytoplasmic stages of cytomegalovirus maturation.IMPORTANCE Viruses are known to exploit specific cellular functions at different stages of their life cycle in order to replicate, avoid immune recognition by the host and to establish a successful infection. Cytomegalovirus (CMV)-infected cells are characterized by a prominent cytoplasmic inclusion (virus assembly compartment [vAC]) that is the site of virus maturation and envelopment. While endocytic membranes are known to be the functional components of vAC, knowledge of specific endocytic pathways implicated in CMV maturation and envelopment is lacking. We show here that dynamin, which is an integral part of host endocytic machinery, is largely dispensable for early stages of CMV infection but is required at a late stage of CMV maturation. Studies on dynamin function in CMV infection will help us understand the host-virus interaction pathways amenable to targeting by conventional small molecules, as well as by newer generation nucleotide-based therapeutics (e.g., small interfering RNA, CRISPR/CAS gRNA, etc.).

RevDate: 2018-10-23

Rui Y, Wilson DR, JJ Green (2018)

Non-Viral Delivery To Enable Genome Editing.

Trends in biotechnology pii:S0167-7799(18)30250-6 [Epub ahead of print].

Genome-editing technologies such as zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENS), and the clustered regularly interspaced short palindromic repeat (CRISPR)-associated protein system have revolutionized biological research. Each biotechnology consists of a DNA-binding protein that can be programmed to recognize and initiate double-strand breaks (DSBs) for site-specific gene modification. These technologies have the potential to be harnessed to cure diseases caused by aberrant gene expression. To be successful therapeutically, their functionality depends on their safe and efficient delivery into the cell nucleus. This review discusses the challenges in the delivery of genome-editing tools, and highlights recent innovations in non-viral delivery that have potential to overcome these limitations and advance the translation of genome editing towards patient care.

RevDate: 2018-11-14
CmpDate: 2018-10-22

Xue T, Liu K, Chen D, et al (2018)

Improved bioethanol production using CRISPR/Cas9 to disrupt the ADH2 gene in Saccharomyces cerevisiae.

World journal of microbiology & biotechnology, 34(10):154 pii:10.1007/s11274-018-2518-4.

Bioethanol, as a form of renewable and clean energy, has become increasingly important to the energy supply. One major obstacle in ethanol production is developing a high-capacity system. Existing approaches for regulating the ethanol production pathway are relatively insufficient, with nonspecific genetic manipulation. Here, we used CRISPR/Cas9 technology to disrupt the alcohol dehydrogenase (ADH) 2 gene via complete deletion of the gene and introduction of a frameshift mutation in the ADH2 locus. Sequencing demonstrated the accurate knockout of the target gene with 91.4% and near 100% targeting efficiency. We also utilized genome resequencing to validate the mutations in the ADH2 mutants targeted by various single-guide RNAs. This extensive analysis indicated the mutations in the CRISPR/Cas9-engineered strains were homozygous. We applied the engineered Saccharomyces cerevisiae strains for bioethanol production. Results showed that the ethanol yield improved by up to 74.7% compared with the yield obtained using the native strain. This work illustrates the applicability of this highly efficient and specific genome engineering approach to promote the improvement of bioethanol production in S. cerevisiae via metabolic engineering. Importantly, this study is the first report of the disruption of a target gene, ADH2, in S. cerevisiae using CRISPR/Cas9 technology to improve bioethanol yield.

RevDate: 2018-11-14
CmpDate: 2018-10-15

Hong KQ, Liu DY, Chen T, et al (2018)

Recent advances in CRISPR/Cas9 mediated genome editing in Bacillus subtilis.

World journal of microbiology & biotechnology, 34(10):153 pii:10.1007/s11274-018-2537-1.

Genome editing using engineered nucleases has rapidly transformed from a niche technology to a mainstream method used in various host cells. Its widespread adoption has been largely developed by the emergence of the clustered regularly interspaced short palindromic repeats (CRISPR) system, which uses an easily customizable specificity RNA-guided DNA endonuclease, such as Cas9. Recently, CRISPR/Cas9 mediated genome engineering has been widely applied to model organisms, including Bacillus subtilis, enabling facile, rapid high-fidelity modification of endogenous native genes. Here, we reviewed the recent progress in B. subtilis gene editing using CRISPR/Cas9 based tools, and highlighted state-of-the-art strategies for design of CRISPR/Cas9 system. Finally, future perspectives on the use of CRISPR/Cas9 genome engineering for sequence-specific genome editing in B. subtilis are provided.

RevDate: 2018-11-16

Morovic W, Roos P, Zabel B, et al (2018)

Transcriptional and Functional Analysis of Bifidobacterium animalis subsp. lactis Exposure to Tetracycline.

Applied and environmental microbiology, 84(23): pii:AEM.01999-18.

Commercial probiotic bacteria must be tested for acquired antibiotic resistance elements to avoid potential transfer to pathogens. The European Food Safety Authority recommends testing resistance using microdilution culture techniques previously used to establish inhibitory thresholds for the Bifidobacterium genus. Many Bifidobacterium animalis subsp. lactis strains exhibit increased resistance to tetracycline, historically attributed to the ribosomal protection gene tet(W). However, some strains that harbor genetically identical tet(W) genes show various inhibition levels, suggesting that other genetic elements also contribute to observed differences. Here, we adapted several molecular assays to confirm the inhibition of B. animalis subsp. lactis strains Bl-04 and HN019 and employed RNA sequencing to assess the transcriptional differences related to genomic polymorphisms. We detected specific stress responses to the antibiotic by correlating ATP concentration to number of viable genome copies from droplet digital PCR and found that the bacteria were still metabolically active in high drug concentrations. Transcriptional analyses revealed that several polymorphic regions, particularly a novel multidrug efflux transporter, were differentially expressed between the strains in each experimental condition, likely having phenotypic effects. We also found that the tet(W) gene was upregulated only during subinhibitory tetracycline concentrations, while two novel tetracycline resistance genes were upregulated at high concentrations. Furthermore, many genes involved in amino acid metabolism and transporter function were upregulated, while genes for complex carbohydrate utilization, protein metabolism, and clustered regularly interspaced short palindromic repeat(s) (CRISPR)-Cas systems were downregulated. These results provide high-throughput means for assessing antibiotic resistances of two highly related probiotic strains and determine the genetic network that contributes to the global tetracycline response.IMPORTANCEBifidobacterium animalis subsp. lactis is widely used in human food and dietary supplements. Although well documented to be safe, B. animalis subsp. lactis strains must not contain transferable antibiotic resistance elements. Many B. animalis subsp. lactis strains have different resistance measurements despite being genetically similar, and the reasons for this are not well understood. In the current study, we sought to examine how genomic differences between two closely related industrial B. animalis subsp. lactis strains contribute to different resistance levels. This will lead to a better understanding of resistance, identify future targets for analysis of transferability, and expand our understanding of tetracycline resistance in bacteria.

RevDate: 2018-11-02
CmpDate: 2018-11-02

He S, Del Viso F, Chen CY, et al (2018)

An axial Hox code controls tissue segmentation and body patterning in Nematostella vectensis.

Science (New York, N.Y.), 361(6409):1377-1380.

Hox genes encode conserved developmental transcription factors that govern anterior-posterior (A-P) pattering in diverse bilaterian animals, which display bilateral symmetry. Although Hox genes are also present within Cnidaria, these simple animals lack a definitive A-P axis, leaving it unclear how and when a functionally integrated Hox code arose during evolution. We used short hairpin RNA (shRNA)-mediated knockdown and CRISPR-Cas9 mutagenesis to demonstrate that a Hox-Gbx network controls radial segmentation of the larval endoderm during development of the sea anemone Nematostella vectensis. Loss of Hox-Gbx activity also elicits marked defects in tentacle patterning along the directive (orthogonal) axis of primary polyps. On the basis of our results, we propose that an axial Hox code may have controlled body patterning and tissue segmentation before the evolution of the bilaterian A-P axis.

RevDate: 2018-11-14
CmpDate: 2018-11-02

Dank A, Smid EJ, RA Notebaart (2018)

CRISPR-Cas genome engineering of esterase activity in Saccharomyces cerevisiae steers aroma formation.

BMC research notes, 11(1):682 pii:10.1186/s13104-018-3788-5.

OBJECTIVE: Saccharomyces cerevisiae is used worldwide for the production of ale-type beers. This yeast is responsible for the production of the characteristic fruity aroma compounds. Esters constitute an important group of aroma active secondary metabolites produced by S. cerevisiae. Previous work suggests that esterase activity, which results in ester degradation, may be the key factor determining the abundance of fruity aroma compounds. Here, we test this hypothesis by deletion of two S. cerevisiae esterases, IAH1 and TIP1, using CRISPR-Cas9 genome editing and by studying the effect of these deletions on esterase activity and extracellular ester pools.

RESULTS: Saccharomyces cerevisiae mutants were constructed lacking esterase IAH1 and/or TIP1 using CRISPR-Cas9 genome editing. Esterase activity using 5-(6)-carboxyfluorescein diacetate (cFDA) as substrate was found to be significantly lower for ΔIAH1 and ΔIAH1ΔTIP1 mutants compared to wild type (WT) activity (P < 0.05 and P < 0.001, respectively). As expected, we observed an increase in relative abundance of acetate and ethyl esters and an increase in ethyl esters in ΔIAH1 and ΔTIP1, respectively. Interestingly, the double gene disruption mutant ΔIAH1ΔTIP1 showed an aroma profile comparable to WT levels, suggesting the existence and activation of a complex regulatory mechanism to compensate multiple genomic alterations in aroma metabolism.

RevDate: 2018-10-05

Hidalgo-Cantabrana C, Goh YJ, R Barrangou (2018)

Characterization and Repurposing of Type I and Type II CRISPR-Cas Systems in Bacteria.

Journal of molecular biology pii:S0022-2836(18)31107-0 [Epub ahead of print].

CRISPR-Cas systems constitute the adaptive immune system of bacteria and archaea, as a sequence-specific nucleic acid targeting defense mechanism. The sequence-specific recognition and cleavage of Cas effector complexes has been harnessed to developed CRISPR-based technologies and drive the genome editing revolution underway, due to their efficacy, efficiency, and ease of implementation in a broad range of organisms. CRISPR-based technologies offer a wide variety of opportunities in genome remodeling and transcriptional regulation, opening new avenues for therapeutic and biotechnological applications. To repurpose CRISPR-Cas systems for these applications, the various elements of the system need to be first identified and functionally characterized in their native host. Bioinformatic tools are first used to identify putative CRISPR arrays and their associated genes, followed by a comprehensive characterization of the CRISPR-Cas system, encompassing predictions for guide and target sequences. Subsequently, interference assays and transcriptomic analyses should be performed to probe the functionality of the CRISPR-Cas system. Once an endogenous CRISPR-Cas system is characterized as functional, they can be readily repurposed by delivering an engineered synthetic CRISPR array or a small RNA guide for targeted gene manipulation. Alternatively, developing a plasmid-based system for heterologous expression of the necessary CRISPR components can enable exploitation in other organisms. Altogether, there is a wide diversity of native CRISPR-Cas systems in many bacteria and most archaea that await functional characterization and repurposing for genome editing applications in prokaryotes.

RevDate: 2018-09-27

Ebrahimi S, Teimoori A, Khanbabaei H, et al (2018)

Harnessing CRISPR/Cas 9 System for manipulation of DNA virus genome.

Reviews in medical virology [Epub ahead of print].

The recent development of the Clustered Regularly Interspaced Palindromic Repeat (CRISPR)/CRISPR-associated protein 9 (Cas9) system, a genome editing system, has many potential applications in virology. The possibility of introducing site specific breaks has provided new possibilities to precisely manipulate viral genomics. Here, we provide diagrams to summarize the steps involved in the process. We also systematically review recent applications of the CRISPR/Cas9 system for manipulation of DNA virus genomics and discuss the therapeutic potential of the system to treat viral diseases.

RevDate: 2018-11-14
CmpDate: 2018-11-12

Xiang G, Ren J, Hai T, et al (2018)

Editing porcine IGF2 regulatory element improved meat production in Chinese Bama pigs.

Cellular and molecular life sciences : CMLS, 75(24):4619-4628.

Insulin-like growth factor 2 (IGF2) is an important growth factor, which promotes growth and development in mammals during fetal and postnatal stages. Using CRISPR-Cas9 system, we generated multiple founder pigs containing 12 different mutant alleles around a regulatory element within the intron 3 of IGF2 gene. Crossing two male founders passed four mutant alleles onto F1 generation, and these mutations abolished repressor ZBED6 binding and rendered this regulatory element nonfunctional. Both founders and F1 animals showed significantly faster growth, without affecting meat quality. These results indicated that editing IGF2 intron 3-3072 site using CRISPR-Cas9 technology improved meat production in Bama pigs. This is the first demonstration that editing non-coding region can improve economic traits in livestock.

LOAD NEXT 100 CITATIONS

ESP Quick Facts

ESP Origins

In the early 1990's, Robert Robbins was a faculty member at Johns Hopkins, where he directed the informatics core of GDB — the human gene-mapping database of the international human genome project. To share papers with colleagues around the world, he set up a small paper-sharing section on his personal web page. This small project evolved into The Electronic Scholarly Publishing Project.

ESP Support

In 1995, Robbins became the VP/IT of the Fred Hutchinson Cancer Research Center in Seattle, WA. Soon after arriving in Seattle, Robbins secured funding, through the ELSI component of the US Human Genome Project, to create the original ESP.ORG web site, with the formal goal of providing free, world-wide access to the literature of classical genetics.

ESP Rationale

Although the methods of molecular biology can seem almost magical to the uninitiated, the original techniques of classical genetics are readily appreciated by one and all: cross individuals that differ in some inherited trait, collect all of the progeny, score their attributes, and propose mechanisms to explain the patterns of inheritance observed.

ESP Goal

In reading the early works of classical genetics, one is drawn, almost inexorably, into ever more complex models, until molecular explanations begin to seem both necessary and natural. At that point, the tools for understanding genome research are at hand. Assisting readers reach this point was the original goal of The Electronic Scholarly Publishing Project.

ESP Usage

Usage of the site grew rapidly and has remained high. Faculty began to use the site for their assigned readings. Other on-line publishers, ranging from The New York Times to Nature referenced ESP materials in their own publications. Nobel laureates (e.g., Joshua Lederberg) regularly used the site and even wrote to suggest changes and improvements.

ESP Content

When the site began, no journals were making their early content available in digital format. As a result, ESP was obliged to digitize classic literature before it could be made available. For many important papers — such as Mendel's original paper or the first genetic map — ESP had to produce entirely new typeset versions of the works, if they were to be available in a high-quality format.

ESP Help

Early support from the DOE component of the Human Genome Project was critically important for getting the ESP project on a firm foundation. Since that funding ended (nearly 20 years ago), the project has been operated as a purely volunteer effort. Anyone wishing to assist in these efforts should send an email to Robbins.

ESP Plans

With the development of methods for adding typeset side notes to PDF files, the ESP project now plans to add annotated versions of some classical papers to its holdings. We also plan to add new reference and pedagogical material. We have already started providing regularly updated, comprehensive bibliographies to the ESP.ORG site.

Click Covers to Order from Amazon

CRISPR-Cas

By delivering the Cas9 nuclease, complexed with a synthetic guide RNA (gRNA) into a cell, the cell's genome can be precisely cut at any desired location, allowing existing genes to be removed and/or new ones added. That is, the CRISPR-Cas system provides a tool for the cut-and-paste editing of genomes. Welcome to the brave new world of genome editing. R. Robbins

Electronic Scholarly Publishing
21454 NE 143rd Street
Woodinville, WA 98077

E-mail: RJR8222 @ gmail.com

Papers in Classical Genetics

The ESP began as an effort to share a handful of key papers from the early days of classical genetics. Now the collection has grown to include hundreds of papers, in full-text format.

Digital Books

Along with papers on classical genetics, ESP offers a collection of full-text digital books, including many works by Darwin (and even a collection of poetry — Chicago Poems by Carl Sandburg).

Timelines

ESP now offers a much improved and expanded collection of timelines, designed to give the user choice over subject matter and dates.

Biographies

Biographical information about many key scientists.

Selected Bibliographies

Bibliographies on several topics of potential interest to the ESP community are now being automatically maintained and generated on the ESP site.

ESP Picks from Around the Web (updated 07 JUL 2018 )